Key Resources Table
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| rat anti-BrdU | Bio-Rad (formerly Serotec) | AbD Serotec Cat# MCA2060 RRID: AB_323427 |
| Mouse anti-BrdU | Millipore | Millipore Cat# MAB3424 RRID: AB_94851 |
| Mouse anti-Cox1 (MTCO1) | Abcam | Abcam Cat# ab14705 RRID: AB_2084810 |
| Guinea pig anti-DCX | Millipore | Millipore Cat# AB2253 RRID: AB_1586992 |
| chicken anti-GFP | Aves | Aves Labs Cat# GFP-1020 RRID: AB_10000240 |
| rabbit anti-GFP | Invitrogen | Thermo Fisher Scientific Cat# A-11122 RRID: AB_221569 |
| Goat anti-HSP60 | Santa Cruz | Santa Cruz Biotechnology Cat# sc-1722 RRID: AB_2233354 |
| rabbit anti-Ki67 | Millipore | Millipore Cat# AB9260, RRID: AB_2142366 |
| rabbit anti-MCM2 | Cell Signaling Technologies | Cell Signaling Technology Cat# 3619S, RRID: AB_2142137 |
| mouse anti-oxPhos | Abcam | Abcam Cat# ab110413, RRID: AB_2629281 |
| mouse anti-Nestin | Millipore | Millipore Cat# MAB353, RRID: AB_94911 |
| rabbit anti-Prox1 | Millipore | Millipore Cat# AB5475, RRID: AB_177485 |
| rabbit anti-Stathmin | Abcam | Abcam Cat# ab47468, RRID: AB_882723 |
| rabbit anti-Tbr2 | Abcam | Abcam Cat# ab23345, RRID: AB_778267 |
| biotinylated goat anti-GFP | Vector Laboratories | Vector Laboratories Cat# BA-0702, RRID: AB_2336121 |
| DyLight 405-conjugated donkey anti-rabbit | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 711-475- 152, RRID: AB_2340616 |
| AMCA-conjugated donkey anti-guinea pig | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 706-155- 148, RRID: AB_2340458 |
| Cy3-conjugated donkey anti-rat | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 712-165- 153, RRID: AB_2340667 |
| Cy3-conjugated donkey anti-rabbit | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 711-165- 152, RRID: AB_2307443 |
| Cy3-conjugated donkey anti-goat | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 705-165- 147, RRID: AB_2307351 |
| FITC-conjugated donkey anti-chicken | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 703-095- 155, RRID: AB_2340356 |
| Alexa 488-conjugated donkey anti-mouse | Invitrogen | Thermo Fisher Scientific Cat# A-21202, RRID: AB_2535788 |
| Cy5-conjugated donkey anti-mouse | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 715-175- 151, RRID: AB_2340820 |
| Cy5-conjugated donkey anti-goat | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 705-175- 147, RRID: AB_2340415 |
| Cy5-conjugated donkey anti-rabbit | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 711-175- 152, RRID: AB_2340607 |
| biotinylated donkey anti-chicken | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 703-065- 155, RRID: AB_2313596 |
| biotinylated donkey anti-mouse | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 715-065- 151, RRID: AB_2340785 |
| biotinylated goat anti-rabbit | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 111-066- 047, RRID: AB_2337969 |
| Alexa 488-Streptavidin | Invitrogen | Thermo Fisher Scientific Cat# S11223, RRID: AB_2336881 |
| Cy3-Streptavidin | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 016-160- 084\\t, RRID: AB_2307342 |
| Cy5-Streptavidin | Jackson Laboratories | Jackson ImmunoResearch Labs Cat# 016-170- 084, RRID: AB_2337245 |
| Gold-conjugated goat anti-rabbit | Nanoprobes | Nanoprobes Cat# 2004, RRID: AB_2631182 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| BrdU | Sigma-Aldrich | Cat#: B5002 |
| Rotenon | Sigma-Aldrich | Cat#: R8875 |
| Oligomycin | Sigma-Aldrich | Cat#: 75351 |
| Piracetam | Sigma-Aldrich | Cat#: P5295 |
| BMP4 | R&D Systems | Cat#: 5020-BP |
| Accutase | Millipore | Cat#: SCR005 |
| Rhodamin-123 | Sigma-Aldrich | Cat#: R8004 |
| Trypan Blue | Sigma-Aldrich | Cat#: T8154 |
| Critical Commercial Assays | ||
| Avidin biotinperoxidase complex (ABC Elite) | Vector Laboratories | PK-6100 |
| DAB | Vector Laboratories | SK-4100 |
| HQ Silver Kit | Nanoprobes | #2012 |
| MACS Neural Tissue Dissociation Kit | Miltenyi Biotec | Cat#: 130-092-628 |
| Bioluminescence Assay | ViaLight Kit Lonza | Cat#: LT07–221 |
| ApoTag Red in Situ Apoptosis Detection Kit | Millipore | Cat#: S7165 |
| Deposited Data | ||
| Single cell sequencing data | Shin et al., 2015 | GEO: GSE71485 |
| Experimental Models: Organisms/Strains | ||
| TfamloxP/loxP mouse; B6.Cg-Tfamtm1.1Ncdl/J | Larsson et al., 1998 | N/A |
| GLAST::CreERT2 mouse; Tg(Slc1a3-cre/ERT)1Nat/J |
Mori et al., 2006 | N/A |
| CAG-CAT-eGFP mouse; FVB.B6-Tg(CAG-cat,-EGFP)1Rbns/KrnzJ |
Nakamura et al., 2006 | N/A |
| hGFAPeGFP mouse; FVB/N-Tg(GFAPGFP)14Mes/J |
Nolte et al., 2001 | N/A |
| Nestin-GFP mouse; B6.Cg-Tg(Nes-EGFP)1Yamm | Yamaguchi et al., 2000 | N/A |
| C57BL/6 mouse | Charles River | Strain code: 027 |
| NMRI | Charles River | N/A |
| Recombinant DNA | ||
| MMLV pCAG-GFP | Zhao et al., 2006 | Addgene 16664 |
| MMLV pCAG-GFP-IRES-Cre | Zhao et al., 2006 | Addgene 48201 |
| Sequence-Based Reagents | ||
| Tfam-A CTGCCTTCCTCTAGCCCGGG | Life Technologies | N/A |
| Tfam-B GTAACAGCAGACAACTTGTG | Life Technologies | N/A |
| Tfam-C CTCTGAAGCACATGGTCAAT | Life Technologies | N/A |
| Software and Algorithms | ||
| Fiji ImageJ software | Schindelin et al., 2012 | https://fiji.sc/ |
| Custom R Code for Hidden Markov Model | Shin et al., 2015 |
http://doi.org/10.1016/j.stem.2015.07.013 Data S1 |
| Reconstruct Software | Fiala, 2005 | http://www.bu.edu/neural/Reconstruct.html |
| Adobe Creative Suite | Adobe | http://www.adobe.com/creativecloud.html |
| Imaris software | Bitplane | http://www.bitplane.com/ |
| XLStat | Addinsoft | https://www.xlstat.com/en/download |