Skip to main content
. Author manuscript; available in PMC: 2018 Feb 8.
Published in final edited form as: Neuron. 2017 Jan 26;93(3):587–605.e7. doi: 10.1016/j.neuron.2016.12.034

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Goat polyclonal anti-mCherry SICGEN Cat# AB0040-200; RRID:AB_2333092
Goat polyclonal anti-GFP SICGEN Cat# AB0020-200; RRID:AB_2333099
Chicken polyclonal anti-GFP Aves Labs Cat# GFP-1020; RRID:AB_10000240
Rabbit polyclonal anti-GFAP Dako Cat# Z0334; RRID:AB_10013382
Rabbit polyclonal anti-GFP (for immuno-EM) Frontier Institute Cat# GFP-Rb-Af2020; RRID:AB_2571573
Donkey anti-Goat IgG (H+L), Alexa Fluor 488 Thermo Fisher Scientific Cat# A-11055; RRID:AB_2534102
Donkey anti-Goat IgG (H+L), Alexa Fluor 546 Thermo Fisher Scientific Cat# A11056; RRID:AB_10584485
Donkey anti-Rabbit IgG (H+L), DyLight 650 Thermo Fisher Scientific Cat# SA5-10049; RRID:AB_2556629
Donkey anti-Chicken IgY (IgG) (H+L), Cy2 Jackson ImmunoResearch Labs Cat# 703-225-155; RRID:AB_2340370
Goat anti-Rabbit Fab′ fragment IgG, NANOGOLD (for immuno-EM) Thermo Fisher Scientific Cat# N24916; RRID:AB_10104359
Experimental Models: Mouse lines
Tg(Slc1a3-cre/ERT)1Nat/J Dr. Jeremy Nathans, Johns Hopkins RRID:IMSR_JAX:012586
B6.Cg-Tg(GFAP-cre/ERT2)505Fmv/J Jackson Laboratory RRID:IMSR_JAX:012849
Itpr2tm1Chen/Itpr2+ Dr. Ju Chen, UC San Diego RRID:MGI:3713675
B6SJL-Tg(SOD1*G93A)1Gur/J Jackson Laboratory RRID:IMSR_JAX:002726
B6;129-Gt(ROSA)26Sor(CAG-mGCaMP3) This paper N/A
B6;129-Gt(ROSA)26Sortm4(CAG-GFP*)Nat/J This paper RRID:IMSR_JAX:021429
B6;129S6-Gt(ROSA)26Sortm14(CAG-tdTomato)Hze/J Jackson Laboratory RRID:IMSR_JAX:007908
Chemicals (Pharmacological compounds)
(S)-3,5-Dihydroxyphenylglycine, DHPG Tocris Cat# 0805; CAS:162870-29-3
Adenosine 5′-triphosphate magnesium salt Sigma-Aldrich Cat# A9187; CAS:74804-12-9
Bafilomycin A1 Enzo Cat# BML-CM110-0100; CAS: 88899-55-2
Benzamil Tocris Cat# 3380; CAS:161804-20-2
Cadmium chloride Sigma-Aldrich Cat# 202908; CAS:10108-64-2
Carbonyl cyanide 4 (trifluoromethoxy)phenylhydrazone (FCCP) Tocris Cat# 0453; CAS:370-86-5
Carboxyatractyloside potassium salt Calbiochem Cat# 216201; CAS:35988-42-2
CGP 37157 Abcam Cat# ab120012; CAS:75450-34-9
Cyclosporin A Tocris Cat# 1101, CAS:59865-13-3
Dantrolene, sodium salt Tocris Cat# 0507; CAS:14663-23-1
DL-TBOA Tocris Cat# 1223; CAS:205309-81-5
GSK-7975A GlaxoSmithKline N/A; CAS:1253186-56-9
HC 030031 Tocris Cat# 2896; CAS:349085-38-7
KB-R7943 mesylate Tocris Cat# 1244; CAS:182004-65-5
L-(−)-Norepinephrine (+)-bitartrate salt monohydrate Sigma-Aldrich Cat# A9512; CAS:108341-18-0
Picrotoxin Sigma-Aldrich Cat# P1675; CAS:124-87-8
Rotenone Tocris Cat# 3616; CAS:83-79-4
Tetrodotoxin citrate Abcam Cat# ab120055; CAS:18660-81-6
Tamoxifen Sigma-Aldrich Cat# T5648; CAS:10540-29-1
Thapsigargin Sigma-Aldrich Cat# T9033; CAS:67526-95-8
Veratridine Tocris Cat# 2918; CAS:71-62-5
Critical Commercial Assays
Neural Tissue Dissociation Kit (P) Miltenyi Biotec Cat# 130-092-628
Recombinant DNA
AAV8-hGFAP-mCherry-2A-Δ9UCP1-WPRE This paper N/A
Sequence-Based Reagents
Primer: tcaatgggcgggggtcgtt (CMV-E-as) (Paukert et al., 2014) N/A
Primer: ctctgctgcctcctggcttct (ROSA26-s) (Paukert et al., 2014) N/A
Primer: cgaggcggatcacaagcaata (ROSA26-as) (Paukert et al., 2014) N/A
Primer: cacgtgatgacaaaccttgg (CaM-s) This paper N/A
Primer: ggcattaaagcagcgtatcc (WPRE-as) This paper N/A
Software and Algorithms
ZEN Blue/Black Zeiss RRID:SCR_013672
ImageJ https://imagej.nih.gov/ij/ RRID:SCR_003070
Fiji http://fiji.sc RRID:SCR_002285
TurboReg http://bigwww.epfl.ch/thevenaz/turboreg/ RRID:SCR_014308
MATLAB (R2014b) MathWorks RRID:SCR_001622
LIBSVM http://www.csie.ntu.edu.tw/~cjlin/libsvm/ RRID:SCR_010243
pClamp 9.2 Molecular Devices RRID:SCR_011323
MiniAnalysis Synaptosoft Inc. RRID:SCR_014441
Origin 8.0 OriginLab Corp. RRID:SCR_014212
Prism 5.0 GraphPad Software RRID:SCR_002798
Adobe Illustrator CS6 Adobe RRID:SCR_014198
CaSCaDe This paper (see Data S1)
HHS Vulnerability Disclosure