REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-ZNF598 (Figure 2A)	GeneTex	Cat. #GTX119245; RRID: AB_10619017
Rabbit polyclonal anti-ZNF598 (Figures 3A and S2C–S3E)	Abcam	Cat. #ab80458; RRID: AB_2221273
Rabbit monoclonal anti-eS10	Abcam	Cat. #ab151550
Rabbit monoclonal anti-uS10	Abcam	Cat. #ab133776
Rabbit polyclonal anti-uS3	Bethyl Labs	Cat. #A303-840A; RRID: AB_2615588
Rabbit polyclonal anti-eS19	Bethyl Labs	Cat. #A304-002A; RRID: AB_2620351
Rabbit polyclonal anti-uS5	Bethyl Labs	Cat. #A303-794A; RRID: AB_11218192
Rabbit polyclonal anti-uS9	Santa Cruz Biotechnology	Cat. #sc-102087; RRID: AB_2269633
Rabbit polyclonal anti-uL6	Santa Cruz Biotechnology	Cat. #sc-102085; RRID: AB_2182219
Rabbit monoclonal anti-uL2	Abcam	Cat. #ab169538
Rabbit monoclonal anti-eS24	Abcam	Cat. #ab196652
Mouse monoclonal anti-HA	Covance Research Products Inc.	Cat. #MMS-101P; RRID: AB_2314672
Mouse monoclonal anti-Flag	Sigma-Aldrich	Cat. #F3165; RRID: AB_259529
Rabbit polyclonal anti-GFP	Chakrabarti and Hegde, 2009	N/A
Rabbit polyclonal anti-RFP	Chakrabarti and Hegde, 2009	N/A
Rabbit polyclonal anti-NEMF	Shao et al., 2015	N/A
HRP conjugated goat anti-rabbit	Jackson Immunoresearch	Cat. #111-035-003; RRID: AB_2313567
HRP conjugated goat anti-mouse	Jackson Immunoresearch	Cat. #115-035-003; RRID: AB_10015289
Chemicals, Peptides, and Recombinant Proteins
3× Flag peptide	Sigma-Aldrich	Cat. #F4799
Anti-Flag M2 affinity resin	Sigma-Aldrich	Cat. #A2220
Ni-NTA agarose	QIAGEN	Cat. #30210
Complete protease inhibitor cocktail, EDTA-free	Roche	Cat. #11 873 580 001
Cycloheximide	Sigma-Aldrich	Cat. #C4859; CAS: 66-81-9
Hygromycin B	Millipore	Cat. #400051-100KU; CAS: 31282-04-9
Blasticidin S	Santa Cruz Biotechnology	Cat. #sc204655; CAS: 3513-03-9
MG132	Cayman Chemical	Cat. #10012628; CAS: 133407-82-6
Doxycycline	Sigma-Aldrich	Cat. #D9891; CAS: 24390-14-5
Creatine phosphate	Roche	Cat. #621714
Creatine kinase	Roche	Cat. #127566
ZNF598-TEV-3xFlag (human)	This study	N/A
His-Ubiquitin	Boston Biochem	Cat. #U-530
HA-Ubiquitin	Boston Biochem	Cat. #U-110
Methylated Ubiquitin	Boston Biochem	Cat. #U-501
UbcH5a	Boston Biochem	Cat. #E2-616
GST-UBE1 (human)	Boston Biochem	Cat. #E-306
USP2-CD	Boston Biochem	Cat. #E-504
Experimental Models: Cell Lines
HEK293T	ATCC	CRL-3216
Flp-In T-REx 293	Thermo Fisher	Cat. #R78007
Recombinant DNA
pcDNA3.1 ZNF598-TEV-3xFlag	This study	N/A
pcDNA3.1 ΔRING-ZNF598-TEV-3xFlag	This study	N/A
pmGFP-P2A-K0-P2A-RFP	This study	N/A
pmGFP-P2A-SL-P2A-RFP	This study	N/A
pmGFP-P2A-(KAAA)12-P2A-RFP	This study	N/A
pmGFP-P2A-(KAAA)20-P2A-RFP	This study	N/A
pmGFP-P2A-(KAAG)12-P2A-RFP	This study	N/A
pmGFP-P2A-(KAAG)20-P2A-RFP	This study	N/A
pmGFP-P2A-(RCGA)10-P2A-RFP	This study	N/A
pmGFP-P2A-(RCGA)20-P2A-RFP	This study	N/A
pmGFP-P2A-(RCGG)20-P2A-RFP	This study	N/A
pcDNA 5/FRT/TO-GFP-P2A-(KAAA)21-P2A-RFP	This study	N/A
pcDNA 5/FRT/TO-GFP-P2A-(K)0-P2A-RFP	This study	N/A
pcDNA 5/FRT/TO-eS10-HA	This study	N/A
pcDNA 5/FRT/TO-eS10-K139R-HA	This study	N/A
pcDNA 5/FRT/TO-eS10-K138R/K139R-HA	This study	N/A
pcDNA 5/FRT/TO-uS10-HA	This study	N/A
pcDNA 5/FRT/TO-uS10-K8R-HA	This study	N/A
pcDNA 5/FRT/TO-uS10-K4R/K8R-HA	This study	N/A
pOG44 Flp-Recombinase Expression Vector	Thermo Fisher	Cat. #V600520
pX330-U6-Chimeric_BB-CBh-hSpCas9	Ran et al., 2013	Addgene Plasmid #42230
Sequence-Based Reagents
Silencer Select Pre-designed siRNA against ZNF598	Life Technologies	Cat. #4392420; siRNA ID #s40509
Silencer Select Pre-designed siRNA against NEMF	Life Technologies	Cat. #4392420; siRNA ID #s17483
Silencer Select Pre-designed siRNA negative control #1	Life Technologies	Cat. #4392420
guide RNA targeting exon 1 of ZNF598 gene 5′-TAGAGCAGCGGTAGCACACC-3′	This study	N/A
Nucleotide sequence of (K)0 insert: CGCCATGGCGACCCCCGGGGGATCC	This study	N/A
Nucleotide sequence of (KAAA)n inserts: CGCCATGGCGACC(AAA)nCCCGGGGGATCC	This study	N/A
Nucleotide sequence of (KAAG)n inserts: CGCCATGGCGACC(AAG)nCCCGGGGGATCC	This study	N/A
Nucleotide sequence of (RCGA)n inserts: CGCCATGGCGACC(CGA)nCCCGGGGGATCC	This study	N/A
Nucleotide sequence of (RCGG)n inserts: CGCCATGGCGACC(CGG)nCCCGGGGGATCC	This study	N/A
Nucleotide sequence of SL insert: CGCCCTGTTCCACTATAGGGCACCTCCCCGCGCACCACCGCCGACGTCGGCGGTGGTGCGCGGGGAGGTGCCCTATAGCGGTAC	This study	N/A
Software and Algorithms
Ensembl BioMart tool (online version)	Flicek et al., 2014	http://www.ensembl.org/biomart
FlowJo 10.1r5	FlowJo, LLC	https://www.flowjo.com/
GraphPad Prism 6.05	GraphPad Software	http://graphpad.com/
Other
TransIt 293	Mirus	Cat. #MIR 2705
Lipofectamine RNAiMAX	Thermo Fisher	Cat. #13778150
SuperSignal West Pico Chemiluminescent substrate	Thermo Fisher	Cat. #34080
Rabbit reticulocyte lysate (RRL)	Green Hectares	N/A
DMEM, high glucose, GlutaMAX Supplement, pyruvate	Thermo Fisher	Cat. #10569010
Tetracycline-free fetal calf serum (FCS)	BioSera	Cat. #FB-1001T/500