Table S5.

Sequences and applications of oligonucleotide primers used in this study

Primer no.	Primer	Sequence (5′→3′)	Features
1	NMT	CTCAGCCACGGTCAATGCGGCCGCGTTTTACCTGTTCTCG	Forward primer used to introduce NotI restriction site
2	NMB	AACAGGTAAAACGCGGCCGCATTGACCGTGGCTGAGGCTC	Reverse primer used to introduce NotI restriction site
3	KMT	CAACCTCGGGTAACGGTACCCTATCGCGCTTCCTGCTTTCCGG	Forward primer used to introduce KpnI restriction site
4	KMB	AAGCAGGAAGCGCGATAGGGTACCGTTACCCGAGGTTGCATGATAGC	Reverse primer used to introduce KpnI restriction site
5	ILM264	GAAGCTCGCGGCTACCCGTGAAAAACTCACCACCACCCTCG	Forward primer used to remove the non-coiled-coil region of WbbB
6	ILM265	TGGTGGTGAGTTTTTCACGGGTAGCCGCGAGCTTCTCACGTTC	Reverse primer used to remove the non-coiled-coil region of WbbB
7	DW01	TCCCAAGACAAAGCGATGCGTGAGAAGCTCGCGGCTACC	Forward primer used to remove four heptads from the WbbB coiled-coil (amino acids 401–434)
8	DW02	CGCGAGCTTCTCACGCATCGCTTTGTCTTGGGAAATGGC	Reverse primer used to remove four heptads from the WbbB coiled-coil (amino acids 401–434)
9	DW10	gatcgctagcATGCACCATCACCATCACCATGTGAAGATACTTATTACTGGCGGG	Forward primer for amplification of rmlB and cloning into pET28a(+); His-tag and NheI restriction site
10	DW11	gatcaagcttTTACTGGCGTCCTTCATAGTTCTG	Reverse primer for the amplification of rmlB and cloning into pET28a(+); HindIII restriction site
11	DW12	gatcgctagcATGCACCATCACCATCACCATGTGATGATTGTGATTAAAACAGCAATACC	Forward primer for amplification of rmlC and cloning into pET28a(+); His-tag and NheI restriction site
12	DW13	gatcaagcttTTACTCTGTTAACAAGGCTTGATCCAG	Reverse primer for the amplification of rmlC and cloning into pET28a(+); HindIII restriction site
13	DW14	gatcgctagcATGCACCATCACCATCACCATATGAATATCTTACTTTTTGGTAAGACAG	Forward primer for amplification of rmlD and cloning into pET28a(+); His-tag and NheI restriction site
14	DW15	gatcgaattcTTAGATGGTTGTCGTCGTAAACATTTC	Reverse primer for the amplification of rmlD and cloning into pET28a(+); EcoRI restriction site
15	DW4	gatcgctagcATGGATTCCGCGCCGGCAGCGGCG	Forward primer for the amplification of WbbB576-871 (isolation of GT1 domain) and cloning in pET28a(+); NheI restriction site
16	DW5	gatcaagctttaagtgatgtgtatggtgatgCTGAAAATACAGGTTTTCATCAATCGA CAGCAAATAACGCTTCAG	Reverse primer for the amplification of WbbB576-871 (isolation of GT1 domain), introduction of a His6-tag and cloning in pET28a(+); HindIII restriction site
17	OL1028	gatcccatggGCCTGCTGTCAAAATCGAAG	Forward primer for the amplification of WbbB540-1106 and cloning into pET28a(+); NcoI restriction site
18	OL1030	gatcctcgaggCGGTTGCGCTTAAACTCCG	Reverse primer for the amplification of WbbB540-1106 and cloning into pET28a(+); XhoI restriction site
19	Bo/l-C-For	TAAccatggaggaggtatctcatATGTCGGGCCGAATTTGC	Forward primer used to introduce NcoI and NdeI restriction sites into the wbbB gene between amino acids 504 and 505
20	Bo/l-C-Rev	catatgagatacctcctccatggttaGGTCAGCTTCCATGACAGGC	Reverse primer used to introduce NcoI and NdeI restriction sites into the wbbB gene between amino acids 504 and 505
21	Bo/l-D-For	TAAccatggaggaggtacttcatATGCAAGACAAAGCGATGAGAAAGATTTTAG	Forward primer used to introduce NcoI and NdeI restriction sites into the wbbB gene between amino acids 401 and 402
22	Bo/l-D-Rev	catatgaagtacctcctccatggTTAGGAAATGGCTTCATTTATCAATGATG	Reverse primer used to introduce NcoI and NdeI restriction sites into the wbbB gene between amino acids 401 and 402
23	DW57	GATCCCATGGATGCTGGCTGTATTTTTACCTCCC	Forward primer for the amplification of WbbBΔ402–539 (coiled-coil region), introduction a NcoI restriction site
24	DW58	gatcaagcttttacttgtcatcgtcatccttataatcGCGGTTGCGCTTAAACTCCG	Reverse primer for the amplification of WbbBΔ402–539 (coiled-coil region), introduction of a FLAG tag and a HindIII restriction site
25	DW73	ATTCTACGGCGATCCTAATTGCGAA GCAGCCGCGGCGTATCTGCAGGAGC	Forward primer used to mutation R738, R739, K740 to alanine.
26	DW74	GCTTCTTCAGCTCCTGCAGATACGCCGC GGC TGCTTCGCAATTAGGATCGCCG	Reverse primer used to mutation R738, R739, K740 to alanine.

Restriction sites are underlined in the sequences, regions of nonchromosomal sequence are identified by lowercase, and nucleotides changed for site-directed mutations are marked in bold.