Skip to main content
. 2017 Mar 1;8:313. doi: 10.3389/fmicb.2017.00313

Figure 1.

Figure 1

Restriction Patterns created with HinfI enzyme from PCR products of exoT and exoS genes. DNA ladder of 100 bp (Invitrogen by Thermo Fisher Scientific, Inc.) and 50 bp (Thermo Fisher Scientific, Inc.) (lines 1 and 8, respectively). PCR products from P. aeruginosa PA14 strain, PAO1 strain and a 1208 clinical strain, the primers: forward 5′ ACTCGTGCGTCCCTTCGTG 3′ and reverse 5′ GATACTCTGCTGACCTCGCTCTC 3′ were used (lines 2, 4, and 6, respectively). Restriction pattern from PA14 strain product, which gave a restriction pattern of two bands for the exoT gene: one of 292 bp and the other of 233 bp (line 3). Restriction pattern from PAO1 strain product, which present both exoT and exoS genes, the bands size correspond to 86, 122, 140, 168, 29, and 233 bp (line 5). Restriction pattern from PCR product of one of our strains, this strain only present the exoS gene, which produced a pattern of four bands: 86, 122, 140, and 168 bp (line 7).