Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| Genes | Tm (¢J) | GC (%) | Primer sequence (5'- 3') | Amplicon size (bp) |
|---|---|---|---|---|
| H3.3B | ||||
| Forward primer | 61.83 | 55 | TGCTGGTTTTTCGCTCGTCG | 105 |
| Reverse primer | 61.43 | 50 | GCCATTTTCTTTCACCCAACGC | |
| GAPDH (real-time PCR) | ||||
| Forward primer | 67.14 | 66.67 | GCAGGGGGGAGCCAAAAGGGT | 219 |
| Reverse primer | 65.37 | 61.90 | TGGGTGGCAGTGATGGCATGG |
PCR, polymerase chain reaction.
