TABLE 2 .
Comparison of small indels that differed between paired serial isolatesa
| CHR | POS | Reference (H99) nucleotide(s) | ALT | Indel result for case: |
Gene ID | Name | Description | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | 15 | 22 | 81 | 87 | |||||||
| 5 | 1378568 | C | CT | 0–1 | CNAG_01037 | MLH3 | DNA mismatch repair protein MLH3 | ||||
| 7 | 623649 | TC | T | 0–1 | CNAG_05690 | RPD304 | Histone deacetylase RPD3 | ||||
| 10 | 405507 | GCTTCCGCTTCCGCTGCACGACCGAGT | G | 0–1 | CNAG_04786 | Hypothetical protein | |||||
| 12 | 126473 | AT | A | 0–1a | CNAG_06033 | pfkB family carbohydrate kinase superfamily | |||||
| 12 | 520033 | CCT | C | 1–0 | CNAG_06174 | GCN2 | Pek/GCN2 protein kinase | ||||
| 13 | 195919 | TC | T | 1–0 | CNAG_06325 | BYR4 | GTPase activator | ||||
a
“0–1” and “1–0” denote the gain and loss, respectively, of a small indel between initial and relapse isolates of the indicated cases. “0” represents a base(s) identical to that in the reference genome (H99), and “1” indicates the alternative (ALT) sequence. CHR, chromosome; POS, position.