Fig. 1.

Schematic representation of R. ruber strain Chol-4 DNA kstD regions. Putative promoters (pP) predicted using the BPROM (pP1: TTCCTT⁻³⁵..TGCTTGAAT⁻¹⁰), PePPER (pP2: TTGAATGCTTTTAGAACGTGTTCCACATCgcgaC⁺¹ and pP3: TGGACTCACCGCGCCATCATTCTATAACgtgtT⁺¹) or NNPP programs (pP4: GGTTGTCGTGGCGGACAAGGTGTGGTCCGAATGATCGGGAC⁺¹TTGGCGATT and pP5: GAAGGGATGGACTCACCGCGCCATCATTC⁺¹TATAACGTG) are shown in grey flags. TSS derived promoters (pKstD1, pKstD2) appear in black flags. Positive (solid line) and negative (dotted line) results of the amplification of co-transcribed products are depicted. hyp hypothetical protein, fadA5 acetyl-CoA acyltransferase, cyp450 cytochrome P450, pep hypothetical peptide, MFSt major facilitator superfamily transporter, kshA 3-ketosteroid 9α-hydroxylase, ox oxidoreductase, Tn transposase, hsaF 4-hydroxy-2-oxovalerate aldolase, hsaG acetaldehyde dehydrogenase, hsaE 2-hydroxypenta-2,4-dienoate hydratase, hsd4B 2-enoyl acyl-CoA hydratase, choG cholesterol oxidase