Table 1.

Primers for real-time quantitative polymerase chain reaction. Sequences for the forward and reverse primers used for RTQ-PCR are given with the GenBank accession number and name for the gene.

Gene	Forward primer	Reverse primer	Accession no.
Acetoacetyl-CoA thiolase	agctcaagacagtgttccagaa	gctccgtcgttcagtgtgc	D13921
HMG-CoA synthase 2	ctgacatcgagggcatagatacc	cagttggcagcgttgaagag	M33648
HMG-CoA lyase	cagaagtttcccggcatcaa	cctgcagctaccgcttcct	AI171090
Pyruvate dehydrogenase kinase, isoenzyme 4	ggattactgaccgcctctttagtt	gcattccgtgaattgtccatc	AF034577