Antibodies |
Guinea pig polyclonal anti-rabies glycoprotein (rabG) |
Eurogentec, Belgium |
N/A |
Goat polyclonal anti-GFP |
Abcam |
Cat#AB6673; RRID: AB_305643 |
Rabbit polyclonal anti-mCherry |
Abcam |
Cat#AB28664; RRID: AB_777698 |
Mouse monoclonal anti-NeuN |
Millipore |
Cat#MAB377; RRID: AB_2298772 |
Rabbit polyclonal anti-GABA |
Sigma |
Cat#A2052; RRID: AB_477652 |
Rabbit polyclonal anti-CaMKII |
Abcam |
Cat#AB52476; RRID: AB_868641 |
Rabbit polyclonal anti-GFP |
Invitrogen |
Cat#A11122; RRID: AB_2307355 |
Goat polyclonal anti-guinea pig alexa 647 |
Invitrogen |
Cat#A21450; RRID: AB_141882 |
Donkey polyclonal anti-goat alexa 488 |
Invitrogen |
Cat#A11055; RRID: AB_142672 |
Donkey polyclonal anti-rabbit alexa 488 |
Invitrogen |
Cat#A21206; RRID: AB_141708 |
Donkey polyclonal anti-rabbit alexa 594 |
Invitrogen |
Cat#A21207; RRID: AB_141637 |
Goat polyclonal anti-mouse alexa 647 |
Invitrogen |
Cat#A31625 |
Goat Polyclonal anti-rabbit Alexa Fluor 488 |
Invitrogen |
Cat#A27034; RRID: AB_2536097 |
Chemicals, Peptides, and Recombinant Proteins |
Blue fluorescent polymer microspheres |
Duke Scientific Corp. |
B500 |
CTB alexa 555 (CTB 555) |
Invitrogen |
C34776 |
Red retrobeads |
Lumafluor |
N/A |
Peptide: CISSWESHKSGGETRL (C terminus of Rabies G) |
Eurogentec, Belgium |
N/A |
Peptide: TTTFKRKHFRPTPDAC (N terminus of Rabies G) |
Eurogentec, Belgium |
N/A |
Strepavidin conjugated to Alexa Fluor 405 |
Invitrogen |
S32351 |
RabiesΔG-mCherry |
This paper |
N/A |
RabiesΔG-GFP |
This paper |
N/A |
RabiesΔG-mCherry-EnVA |
This paper |
N/A |
RabiesΔG-GFP-EnVA |
This paper |
N/A |
RabiesΔG-ArchT-GFP |
This paper |
N/A |
CAV-Cre |
Kremer E., University of Montpellier, France; Soudais et al., 2001. |
N/A |
HSV-EF1α-Cre-Venus |
BioVex (London, UK) |
N/A |
HSV-EF1α-GFP |
BioVex (London, UK) |
N/A |
AAV2/9-CMV-Cre |
Penn Vector Core |
N/A |
AAV2/7-EF1α-DIO-G |
Penn Vector Core |
N/A |
AAV2/9-EF1α-DIO-eNpHR3.0-EYFP |
Penn Vector Core |
N/A |
AAV2/1-CAG-DIO-GFP |
Penn Vector Core |
N/A |
AAV2/5-EF1a-DIO-ChR2-EYFP |
Penn Vector Core |
N/A |
AAV2/5-CaMKII-GCaMP6f |
Penn Vector Core |
N/A |
AAV2/7-EF1α-DIO-TVA-2a-G |
Roska B., FMI, Basel; Yonehara et al., 2013. |
N/A |
TTX |
Latoxan, Valence, France |
L8503 |
CNQX |
Tocris Bioscience, Bristol, UK |
1045 |
R-CPP |
Tocris Bioscience, Bristol, UK |
0247 |
QX-314 |
Tocris Bioscience, Bristol, UK |
2313 |
Picrotoxin |
Sigma-Aldrich |
P1675 |
Fetal bovine serum (FBS) |
Hyclone |
SH30070.03 |
Critical Commercial Assays |
Rapid DNA Ligation Kit |
Roche |
11 635 379 001 |
Plasmid DNA Purification |
MACHEREY-NAGEL |
N/A |
Endotoxin-free Plasmid DNA Purification |
MACHEREY-NAGEL |
N/A |
In-Fusion HD cloning kit |
Clontech |
639649 |
Experimental Models: Cell Lines |
B7GG |
Callaway E., Salk Institute |
N/A |
BHK-EnVA |
Callaway E., Salk Institute |
N/A |
HEK293-TVA |
Young J., Salk Institute |
N/A |
HEK293T |
Callaway E., Salk Institute |
N/A |
Experimental Models: Organisms/Strains |
C57BL6/J |
Harlan Ltd |
N/A |
hCAR (transgenic expression of a truncated human receptor for CAV-Cre) |
Pettersson, S., Karolinska Institutet, Tallone et al., 2001
|
N/A |
LSL-R26Tva-lacZ (Rosa-LSL-TVA, Cre-dependent TVA expression) |
Saur, D., Technische Universitat Munchen, Seidler et al., 2008
|
N/A |
GAD2Cre
|
Huang, Z. J., Cold Spring Harbor Laboratory, Taniguchi et al., 2011
|
N/A |
GAD2Cre::LSL-R26Tva-lacZ (GAD2-Cre-TVA) |
This paper |
N/A |
C57BL6/J::hCAR (F1) |
This paper |
N/A |
Recombinant DNA |
pSADΔG-ArchT-GFP |
This paper |
N/A |
pAAV-EF1α-DIO-rabG |
This paper |
N/A |
pcDNA-B19N |
Callaway E., Salk Institute |
N/A |
pcDNA-B19P |
Callaway E., Salk Institute |
N/A |
pcDNA-B19L |
Callaway E., Salk Institute |
N/A |
pcDNA-B19G |
Callaway E., Salk Institute |
N/A |
pSADΔG-F3 |
Callaway E., Salk Institute |
N/A |
Sequence-Based Reagents |
NheI-covering forward primer for Rabies G (GGCCAAGCTAGCATGGTTCCTCAGGCTCTCCTGT) |
Sigma-Aldrich |
N/A |
AscI-covering reverse primer for Rabies G (TTAAGGCGCGCCTTACAGTCTGGTCTCACCCCC) |
Sigma-Aldrich |
N/A |
Software and Algorithms |
ImageJ |
NIH |
https://imagej.nih.gov/ij/ |
Fiji 1.48 |
|
http://fiji.sc/ |
TrackEM plugin in Fiji 1.48 |
Cardona A. and Saalfeld S. |
http://imagej.net/TrakEM2 |
Turboreg plugin in ImageJ |
Thévenaz et al., 1998 |
N/A |
GraphPad Prism |
GraphPad Software Inc |
http://www.graphpad.com/scientific-software/prism/ |
Imaris 7.3.1 |
Bitplane |
www.bitplane.com/imaris/imaris |
MATLAB |
The MathWorks, Inc. |
http://ch.mathworks.com/products/matlab |
IGOR Pro |
WaveMetrics |
https://www.wavemetrics.com/ |
Neuromatic plug-in for IGOR Pro |
Jason Rothman |
https://www.neuromatic.thinkrandom.com |
Zen softwares |
Zeiss |
http://www.zeiss.com/corporate/en_de/global/home.html |
pClamp 10 |
Axon instruments |
https://www.moleculardevices.com/ |
Other |
Optic fibers |
Thorlabs |
BFH48-200 |
Custom built optrode |
Lüthi A., FMI, Basel; Wolff et al., 2014
|
N/A |
Miniature epifluorescence microscope |
Inscopix |
nVista HD, version 2 |
Gradient index lens |
Inscopix |
GLP-0673 |
Blue (465 nm, 10 mW) and yellow (590 nm, 2.5 mW) LED with LED-driver LD-1 |
Plexon |
N/A |
Yellow laser (589 nm wavelength) |
CNI Lasers, China |
MBL589 |