Table 3. Translation efficiency of ‘AG-rich 5΄-UTR’ mRNA and its mutant forms.
| Name | 5΄-UTR sequence | Relative translation efficiency* | Predicted translation efficiency# |
|---|---|---|---|
| Control | GGAGAAGGAGAUAUCAU | 1 | 1 |
| AG-rich 5΄-UTR | GGAGUCUAAAGAGAGAGAGAGU | 5.09 | 2.05 |
| AG-rich 5΄-UTR –AG1-3 | GGAGUCUAAACACACAGAGAGU | 0.15 | 0.13 |
| AG-rich 5΄-UTR –AG4-6 | GGAGUCUAAAGAGAGACACACU | 1.40 | 0.58 |
| AG-rich 5΄-UTR +SD1 | GGAGUCUAAAGAGAGGAGAAGU | 1.52 | 4.18 |
| AG-rich 5΄-UTR +SD2 | GGAGUCUAAAGGAGGAGAGAGU | 1.56 | 12.37 |
| AG-rich 5΄-UTR -G | GGAGUCUAAAGAGACAGAGAGU | 1.14 | 0.31 |
| 4/16 | CCGGAGCACACACAACAACU | 0.02 | 0.04 |
*Relative values of fluorescence of CER protein, whose mRNA contained 5΄-UTR shown and RFP protein whose mRNA contained ‘Control’ 5΄-UTR.
#Relative translation efficiencies predicted by RBS calculator on the basis of known mRNA features affection translation.