Table 3.
Amplification statistics for one Ferritin-1, one BHLH-1, one IRT-1 gene specific primer pairs, and one primer pair for each reference gene (GADPH, Actin).
Gene | Forward sequence | Reverse sequence | Tm (°C) | Size (bp) | Slope | R2 | E | Reference |
---|---|---|---|---|---|---|---|---|
Ferritin-1 | AGATATCCGAGTATGTTGCTCAG | AAGATGCACGAATGAAGCAGAAA | 61 | 84 | –3.32 | 0.9968 | 100.07 | Current work |
IRT-1 | GTCGCTGTTTTGCTAGGTGC | GTGAGCTTCTCCTCTTCCCT | 61 | 159 | –3.12 | 0.9954 | 109.18 | Current work |
BHLH-1 | TTATTAGGGTTAGACTCAACGCA | TTGCGATCTTTGGTTCCCA | 59 | 74 | –0.02 | 0.0034 | 6.55e+42 | Sen Gupta et al., 2016 |
GADPH | TGGGCGAAAACTCCACTTTG | GAATTGCTGCAGCCTTGTGA | 60 | 57 | –3.15 | 0.9954 | 107.71 | Saha and Vandemark, 2012 |
Actin | CCAAATCATGTTTGAGGCTTTTAA | GTGAAAGAACGGCCTGAATAGC | 60 | 64 | –3.55 | 0.9972 | 91.25 | Saha and Vandemark, 2012 |
Here, Tm = melting temperature, Size = amplicon length, Slope = slope of the trend line in amplification efficiency graph, R2= regression coefficient, E = amplification efficiency.