Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Oligonucleotide sequences for quantitative PCR
| Primer or probe | Oligonucleotide sequence (5′–3′) | Tm (°C) | Amplicon size (bp) |
|---|---|---|---|
| Chicken and duck ND5-F | ACCTCCCCCAACTAGC | 53.6 | 172 |
| Chicken and duck ND5-R | TTGCCAATGGTTAGGCAGGAG | 57.7 | |
| Chicken and duck ND5-P | (FAM)TCAACCCATGCCTTCTT(NFQ-MGB) | 61.1 | |
| Chicken and duck cytb-F | AAATCCCACCCCCTACTAAAAATAAT | 54.3 | 263 |
| Chicken and duck cytb-R | CAGATGAAGAAGAATGAGGCG | 53.4 | |
| Chicken and duck cytb-P | (FAM)ACAACTCCCTAATCGACCT(NFQ-MGB) | 62.7 |
