Skip to main content
. 2017 Apr 20;24(4):458–470.e18. doi: 10.1016/j.chembiol.2017.03.002
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies

FITC-conjugated anti-BrdU antibody BioLegend Cat# 364104 RRID:AB_2564481
rabbit polyclonal anti-cyclin D1 Santa Cruz Biotechnology Cat# sc-753 RRID:AB_2070433
mouse monoclonal anti-Cyclin D3 Cell Signaling Technology Cat# 2936 RRID:AB_2070801
polyclonal anti-p53 Santa Cruz Biotechnology Cat# sc-6243 RRID:AB_653753
rabbit monoclonal anti-p21 Cell Signaling Technology Cat# 2947 RRID:AB_823586
rabbit monoclonal anti-p27 Cell Signaling Technology Cat# 3686 RRID:AB_2077850
mouse monoclonal anti-Cyclin A2 Cell Signaling Technology Cat# 4656 RRID:AB_2071958
mouse monoclonal anti-Cyclin E1 Cell Signaling Technology Cat# 4129 RRID:AB_2071200
rabbit monoclonal anti-p-Akt(S473) Cell Signaling Technology Cat# 4060 RRID:AB_2315049
rabbit monoclonal anti-p-GSK-3β(S9) Cell Signaling Technology Cat# 5558 RRID:AB_10013750
mouse monoclonal anti-Aurora A Santa Cruz Biotechnology Cat# sc-373856 RRID:AB_10988868
rabbit polyclonal anti-cyclin A1 Santa Cruz Biotechnology Cat# sc-7252 RRID:AB_1562274
rabbit monoclonal anti-GAPDH Cell Signaling Technology Cat# 2118 RRID:AB_561053
rabbit monoclonal anti-α-Tubulin Cell Signaling Technology Cat# 2125 RRID:AB_2619646
goat peroxidase-conjugated anti-rabbit Cell Signaling Technology Cat# 7074 RRID:AB_2099233
horse peroxidase-conjugated anti-mouse Cell Signaling Technology Cat# 7076 RRID:AB_330924

Bacterial and Virus Strains

One Shot® BL21(DE3) Chemically Competent/E. coli/ Invitrogen (Thermo Fisher Scientific) Cat#C600003

Chemicals, Peptides, and Recombinant Proteins

THIAZOLYL BLUE TETRAZOLIUM BROMIDE, MTT Sigma Aldrich Cat#M5655-1G; CAS: 298-93-1
Dimethyl sulfoxide, DMSO, Hybri-Max (for cell treatment and cryopreservation) Sigma Aldrich Cat#D2650-5X10ML; CAS: 67-68-5
5-Bromo-2′-deoxyuridine (BrdU) BioUltra, ≥99% Sigma Aldrich Cat#B9285-50MG; CAS: 59-14-3
Staurosporine Santa Cruz Biotechnology Cat# sc-3510 A; CAS: 62996-74-1
Propidium Iodide (PI) Serva Cat#33671.01; CAS: 25535-16-4
Hoechst 33342 Thermo Fisher Scientific Cat#62249; CAS: 23491-52-3
RIPA buffer Sigma Aldrich Cat#R0278-50ML
Protease inhibitor cocktail Sigma Aldrich Cat#P8340-5ML
Phosphatase inhibitor cocktail Roche Cat#04 906 845 001
Albumin, Bovine, Fraction V. Heat Shock Isolation (BSA) BioShop Cat#ALB001.250
Clarity Western ECL Substrate BioRad Cat#1705061
Lipofectamine 2000 Life Technologies Cat#11668-027
Renozol GenoPlast Biochemicals Cat#BMGPB1100-2
M-MLV Reverse Transcriptase Promega Cat# M1701
Hydroxylamine solution 50 wt. % in H2O Sigma Aldrich Cat# 438227; CAS: 7803-49-8
Lithocholic acid Sigma Aldrich Cat# L6250; CAS: 434-13-9
Glycine Sigma Aldrich Cat# 410225; CAS: 56-40-6
Ammonium hydroxide solution Sigma Aldrich Cat# 09859; CAS: 13550-49-7
4-(2-Aminoethyl)morpholine Sigma Aldrich Cat# A55004; CAS: 2038-03-1
Acetyl chloride Sigma Aldrich Cat# 320129; CAS: 75-36-5
Chromium(VI) oxide Sigma Aldrich Cat# 675644; CAS: 1333-82-0
Morpholine Sigma Aldrich Cat# 394467; CAS: 110-91-8
Isobutyl chloroformate Sigma Aldrich Cat# 177989; CAS: 543-27-1
DIC Sigma Aldrich Cat# D125407; CAS: 693-13-0
Chloroform-d Armar Cat# 013300.2040; CAS: 865-49-6
DMSO-d6 Armar Cat# 015600.2035; CAS: 2206-27-1
Sulfuric acid POCH Cat# 575000115; CAS: 7664-93-9
Acetic acid POCH Cat# 568760421; CAS: 64-19-7
Methanol POCH Cat# 621990426; CAS: 67-56-1
Dichloromethane POCH Cat# 628410421; CAS: 75-09-2
TEA POCH Cat# 848930423; CAS: 121-44-8
Acetonitrile POCH Cat# 102640111; CAS: 75-05-8
Sodium Bicarbonate POCH Cat# 810530115; CAS: 144-55-8
Sodium Sulfate Anhydrous POCH Cat# 807870111; CAS: 7727-73-3
LB BROTH (MILLER) BioShop Cat#LBL407.5
IPTG, Reagent Grade, min 99% BioShop Cat#IPT002.25; CAS: 367-93-1
Phenylmethanesulfonyl fluoride (PMSF) Sigma Aldrich Cat#P7626; CAS: 329-98-6
Chelating Sepharose Fast Flow GE Healthcare Cat#17057502
Q Sepharose Fast Flow GE Healthcare Cat#17051001
Ubiquitin-AMC VIVA Bioscience Cat#VB2906-0050
Di-Ubiquitin K63-2 LifeSensors Cat#DU6302
NSC-632839 LifeSensors Cat#SI9689; CAS: 157654-67-6
SYPRO® Orange Protein Gel Stain Thermo Fisher Scientific Cat#S6650
vector pGEX-6p-1 GE Healthcare Cat#28-9546-48
PreScission Protease GE Healthcare Cat# 27-0843-01
Recombinant USP2 (258-605) This paper N/A
Recombinant Ubiquitin (1-76) This paper N/A
Recombinant USP7 (208-561) This paper N/A
DUB enzymes and ubiquitin for MALDI TOF High Throughput DUB Activity Assay (Ritorto et al., 2014) N/A

Critical Commercial Assays

CytoTox-ONE™ Homogeneous Membrane Integrity Assay Promega Cat# G7891
Caspase-Glo® 3/7 Assay Promega Cat# G8091
GoTaq qPCR Master Mix Promega Cat# A6001

Experimental Models: Cell Lines

Human: HCT116 ECACC Cat# 91091005, RRID:CVCL_0291
Human: U-2 OS ECACC Cat# 92022711, RRID:CVCL_0042
Human: SAOS-2 ECACC Cat# 89050205, RRID:CVCL_0548
Human: MCF-7 ECACC Cat# 86012803, RRID:CVCL_0031

Oligonucleotides

Human cyclin D1 siRNA Santa Cruz Biotechnology Cat# sc-29286
siRNA-A Santa Cruz Biotechnology Cat# sc-37007
siRNA-B Santa Cruz Biotechnology Cat# sc-44230
siRNA-C Santa Cruz Biotechnology Cat# sc-44231
Oligo-dT:
TTTTTTTTTTTTTTT
Genomed N/A
RT PCR CCND1 mRNA primer 1:
TGCCAACCTCCTCAACGACCG
This paper N/A
RT PCR CCND1 mRNA primer 2:
TCGCAGACCTCCAGCATCCAG
This paper N/A
RT PCR GAPDH mRNA primer 1:
TGCACCACCAACTGCTTAGC
Genomed ; (Yin et al., 2001) N/A
RT PCR GAPDH mRNA primer 2:
GGCATGGACTGTGGTCATGAG
Genomed; (Yin et al., 2001) N/A
Mycoplasma detection primer 1:
GPO-1: ACTCCTACGGGAGGCAGCAGTA
Genomed; (van Kuppeveld et al., 1992) N/A
Mycoplasma detection primer 2:
MGSO: TGCACCATCTGTCACTCTGTTAACCTC
Genomed; (van Kuppeveld et al., 1992) N/A
USP7 (208-561) primer forward:
GCTACTCGAGTTACTATTCCTGCCGCTCC
Genomed N/A
USP7 (208-561) primer reverse:
GCAAGGATCCAAGAAGCACACAGGCTAC
Genomed N/A

Recombinant DNA

pet16b-UB (1-76, human) Prof. Stefan Jentsch, Max Planck Institute for Biochemistry, Munich, Germany; (Beers and Callis, 1993) N/A
pet24a-USP2 (258-605, human) Prof. Tad Holak, Max Planck Institute for Biochemistry, Munich, Germany; (Renatus et al., 2006) N/A
human USP7 ORF BioScience OCABo5050A1122D
pGEX-6p-1-USP7 (208-561, human) This paper N/A

Software and Algorithms

ModFit LT Software v4.1.7 Verity Software House http://www.vsh.com/products/mflt/index.asp
Image Lab v5.0 BioRad http://www.bio-rad.com/en-us/product/image-lab-software
ImageJ 1.48v Schneider et al., 2012 https://imagej.nih.gov/ij/