KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-CDP M-222 | Santa Cruz | Cat# SC-13024, RRID:AB_2261231 |
| Rat polyclonal anti-CLASP1 | Abnova | Cat# MAB9736, RRID:AB_10754999 |
| Rat polyclonal anti-CLASP2 | Abnova | Cat# MAB9738, RRID:AB_10757498 |
| Rabbit polyclonal anti-Dab1 | Dr. J. Herz from UT Southwestern | N/A |
| Mouse monoclonal anti-GFP | Neuromab | Cat# 75-131, RRID:AB_10671445 |
| Rabbit polyclonal anti-GFP | Synaptic Systems | Cat# 132 002, RRID:AB_887725 |
| Mouse monoclonal anti-GM130 | BD Biosciences | Cat# 610822, RRID:AB_398141 |
| Mouse monoclonal anti-Ki67 | Cell Signaling | Cat# 12202, RRID:AB_2620142 |
| Mouse monoclonal anti-Nestin | BD Biosciences | Cat# 611658, RRID:AB_399176 |
| Mouse monoclonal anti-Pericentrin | BD Biosciences | Cat# 611814, RRID:AB_399294 |
| Rabbit polyclonal anti-PH3 | Cell Signaling | Cat# 9701, RRID:AB_331534 |
| Goat polyclonal anti-Sox2 | Santa Cruz | Cat# SC-17320, RRID:AB_2286684 |
| Mouse monoclonal anti-Tau1 | Millipore | Cat# MAB3420, RRID:AB_94855 |
| Rabbit polyclonal anti-Tbr2 | Abcam | Cat# AB23345, RRID:AB_778267 |
| Biological Samples | ||
| Adult brain tissue from C57Bl/6, Reeler mice, ApoER2/VLDR double knockout and Dab1 knockout mice | Dr. J. Herz from UT Southwestern | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Critical Commercial Assays | ||
| RNeasy Mini Kit | QIAGEN | Cat# 74104 |
| Click-iT EdU Alexa Fluor 488 Flow Cytometry Assay Kit | ThermoFisher Scientific | Cat# C10425 |
| Deposited Data | ||
| Gene expression data from 3 different Reeler mouse models and controls | GEO | GSE94896, https://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc=GSE94896 |
| Experimental Models: Cell Lines | ||
| Human: Human Embryonic Kidney (HEK) 293T cells | ATCC | Cat# CRL-11268, RRID:CVCL_1926 |
| Human: HEK293 stable cell line producing Reelin | Beffert et al., 2002 | |
| Experimental Models: Organisms/Strains | ||
| Mouse: C57BL/6J6 | The Jackson Laboratory | Stock No: 000664, RRID:IMSR_JAX:00 0664 |
| Mouse: CD-1 IGS | Charles River Laboratories | Cat# CRL:022, RRID:IMSR_CRL:022 |
| Recombinant DNA | ||
| pLKO.1 | Addgene | 10879 |
| pSico | Addgene | 11578 |
| pEGFP-C1 | Clontech | Cat# 632470 |
| pEGFP-C3 | Clontech | Cat# 632482 |
| pCGLH | Gal et al., 2006 | N/A |
| pCAG | Gal et al., 2006 | N/A |
| pFUW | Ho et al., 2006 | N/A |
| RSV/REV | Ho et al., 2006 | N/A |
| MDlg/RRE | Ho et al., 2006 | N/A |
| VSVG | Ho et al., 2006 | N/A |
| pENTR/D-TOPA EGFP-CLASP2α WT | Kumar et al., 2009 | N/A |
| pENTR/D-TOPA EGFP-CLASP2α 9SxA | Kumar et al., 2009 | N/A |
| pENTR/D-TOPA EGFP-CLASP2α 8SxD | Kumar et al., 2009 | N/A |
| DCX-Cre-IRES-mCherry | Franco et al., 2011 | N/A |
| Human CLASP2α | IMAGE clone 9021646 | BC140778 |
| Mouse CLASPγ | This paper | N/A |
| pLKO.1-CLASP2 shRNA-A | This paper | N/A |
| pLKO.1-CLASP2 shRNA-B | This paper | N/A |
| pLKO.1-control scrambled | This paper | N/A |
| pSico-CLASP2 shRNA-A | This paper | N/A |
| pSico-CLASP2 shRNA-B | This paper | N/A |
| pCGLH-CLASP2 shRNA-A | This paper | N/A |
| pCGLH-CLASP2 shRNA-B | This paper | N/A |
| pCGLH-control scrambled | This paper | N/A |
| pCAG-CLASP2α | This paper | N/A |
| pCAG-CLASP2γ | This paper | N/A |
| pEGFP-CLASP2α | This paper | N/A |
| pEGFP-CLASP2γ | This paper | N/A |
| pFUW-GFP-CLASP2α WT | This paper | N/A |
| pFUW-GFP-CLASP2α 9SxA | This paper | N/A |
| pFUW-GFP-CLASP2α 8SxD | This paper | N/A |
| pEGFP-CLASP2α 1-820 | This paper | N/A |
| pEGFP-CLASP2α 821-1515 | This paper | N/A |
| pEGFP-CLASP2α 1-270 | This paper | N/A |
| pEGFP-CLASP2α 271-573 | This paper | N/A |
| pEGFP-CLASP2α 574-820 | This paper | N/A |
| pEGFP-CLASP2α 821-1200 | This paper | N/A |
| pEGFP-CLASP2α 1200-1515 | This paper | N/A |
| Sequence-Based Reagents | ||
| GeneChip Mouse Genome 430 2.0 Array | Affymetrix | |
| shRNA targeting sequences for mouse CLASP2 shRNA-A GCATCAGTCCTTTCAACAAGT shRNA-B GAACTTGAAGAGACGTTAAAT |
Beffert et al., 2012 | N/A |
| shRNA control scrambled CCGCAGGTATGCACGCGT | Beffert et al., 2012 | N/A |
| Software and Algorithms | ||
| ImageJ software | NIH | http://imagej.nih.gov/ij/ RRID:SCR_003070 |
| Image Studio 5.2.5 | LI-COR Biosciences | https://www.licor.com/bio/products/software/image_studio/ RRID:SCR_013430 |
| Ingenuity Pathway Analysis | Ingenuity | http://www.ingenuity.com/products/ipa RRID:SCR_008653 |
| Prism 6 | GraphPad | https://www.graphpad.com/scientific-software/prism/ RRID:SCR_002798 |
| Volocity software | Improvision | http://www.perkinelmer.com/lab-solutions/resources/docs/BRO_VolocityBrochure_PerkinElmer.pdf RRID:SCR_002668 |
| ZEN software | Zeiss Microscope | https://www.zeiss.com/microscopy/int/products/microscope-software/zen.html RRID:SCR_013672 |
| Other | ||