Table 2.
Genomic Sequences Targeted by TALENs
| Targeted Sequence 5′–3′ | |
|---|---|
| MYC (TAL-8) | tcccccgctggaaaccttgcacctcggacgctcctgctcctgcccccacctga |
| IGH (TAL-14) | tggcatcgcccttgtctaa |
| 4q35 (TAL4) | tgctacagcactagtgaaactgcaataccacagacagccaactggggaagaaa |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.