Table 1.

Comparison of the intron 1 region of the alpha tubulin published sequences of H. triffittae (GenBank GQ984228) and H. heydorni (GenBank GQ984230) to the sequenced samples, tentatively identified as Hammondia based on JS4/JS5 PCR results. The sample sequences lack the 9 bp repetitive insertion thereby confirming their identity as H. heydorni and not H. triffittae.

Sample	Nucleotides sequenced	Identity	Sequence (3’-5’)
HtRtVulpes-1981-N (H. triffittae)	GenBank GQ984228	--	ATGTGTGCATGGAGTGCATGGTAAA
HhCanis-2000-1-N (H. heydorni)	GenBank GQ984230	--	ATGTGTGCATGG– – – – – – – – –TAAA
Wild canid 1	162	97% H. heydorni	ATGTGTGCATGG– – – – – – – – –TAAC
Wild canid 2	136	98% H. heydorni	ATGTGTGCATGG– – – – – – – – –TAAG
Wild canid 3	146	99% H. heydorni	ATGTGTGCATGG– – – – – – – – –TAAG