HBP1 occupies its affinity site in the Pim-1 promoter.
A, HBP1 binding to the endogenous Pim-1 promoter requires the HMG domain. ChIPs were used to test the binding of exogenous HBP1 to the endogenous Pim-1 gene. HEK293T cells were transfected with HA-HBP1, HA-pmHMG, or HA-delEx7. The region from position bp −1423 to position bp −1451 contains the HBP1 element and was analyzed by specific PCR. Anti-HA antibody or control IgG was used in the indicated lanes. B and C, EMSAs were performed by using a biotin-labeled WT probe (bio-WT; containing the HBP1 affinity site). 10-μg amounts of nuclear extracts from HEK293T cells expressing HA-HBP1 (B), HA-pmHMG, or HA-delEx7 (C) were used. The probe (TAGAAAACTTTCAAAGGAAACATTTA) and the mutant probe (TAGAAAACTTTACCCTGAAACATTTA) were used as unlabeled competitors at a 100-fold excess. The presence of specific complexes, including supershifted HA-HBP1 in the complexes, is indicated (B).