Table 1.

PvRBSA mutations found by comparing the nucleotide and amino acid sequences of P. vivax VCG-I and Sal-1 strains

Changes in PvRBSA nucleotide sequence in Sal-I and VCG-I P. vivax strainsa	Changes in PvRBSA aa sequences in Sal-I and VCG-I P. vivax strainsa	Mutation
c.29A > G	p.Tyr10Cys	Non-synonymous
c.391_411delCTAACAGGAAGTAATGAATCC	p.Leu131_Ser137delb	Deletion
c.533 T > G	p.Phe178Cys	Non-synonymous
c.796A > G	p.Lys266Gly	Non-synonymous
c.797A > G	p.Lys266Gly	Non-synonymous
c.801 T > A	p.Ser267Arg	Non-synonymous
c.803A > C	p.Tyr268Ser	Non-synonymous
c.808C > G	p.His270Asp	Non-synonymous
c.845C > T	p.Pro282Leu	Non-synonymous
c.1029 T > C	p.Lys343Lys	Synonymous
c.1091G > C	p.Trp364Ser	Non-synonymous

^aNucleotide and amino acid positions are numbered according to the Sal-I reference strain sequence alignment with the VCG-I strain

^bRelative location for a region having 4 identical tandem repeats from amino acid position 103 to 130 in the VCG-I strain