Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of the M. chimaera-specific TaqMan primers and probea
| Probe or primer | ID | Sequence (5′–3′) | Position in ANZ045 chromosome |
|---|---|---|---|
| TaqMan probe | 1970-P | ACTCAAACACCTGACGAGTCA | 2,049,950–2,049,970 |
| Forward primer | 1939-F | ACTTGACGAGGTCTTGCAGG | 2,049,919–2,049,938 |
| Reverse primer | 2017-R | GACGGCATAGAGATTCGCCA | 2,049,978–2,049,997 |
The M. chimaera-specific region for the probe and primers was SR1. The TaqMan amplicon length was 79 bp.
