Table 1.

Sequences and thrombin binding of library clones after round 10. Dissociation constants are derived from triplicate measurement in nitrocellulose filter binding assays, and the error reported is the standard error of the curve fit. Each oligo also contains 5′ and 3′ sequences complementary to the capture strand and reverse primer, respectively, which are presented together with binding curves for each clone in the Supplementary Information.

Clone ID	Sequence	Kd (nM)	Fbmax
1	UGUUACUCAC $\mathrm{A}$ $\mathrm{A}$A $\mathrm{A}$UAGCGAAG $\mathrm{A}$CU	44.7 ± 4.6	95.6 ± 4.4
2	CCGGCGUCAC $\mathrm{A}$ $\mathrm{A}$G $\mathrm{A}$UAGACAAA $\mathrm{A}$CU	3.5 ± 0.3	80.6 ± 1.6
3	CGGGACUCAC $\mathrm{A}$ $\mathrm{A}$G $\mathrm{A}$UAGACAAU $\mathrm{A}$CU	2.4 ± 0.3	65.3 ± 1.9
4	UGCGGAUAAC $\mathrm{A}$ $\mathrm{A}$G $\mathrm{A}$UAGCAAAG $\mathrm{A}$CU	10.0 ± 0.9	84.5 ± 2.3
5	CUACCGU $\mathrm{A}$ $\mathrm{A}$GAGAACGAGC $\mathrm{A}$GACUC	NB	ND
6	CGGGACACU $\mathrm{A}$ $\mathrm{A}$GGAACAUAAA $\mathrm{A}$GUU	13.8 ± 1.9	74.5 ± 3.2
7	CCGAAGCUCGGAGAAGCACAGAAGC	NB	ND
8	GGGAUUGCAC $\mathrm{A}$ $\mathrm{A}$G $\mathrm{A}$UAGCGUAG $\mathrm{A}$CU	1.6 ± 0.4	63.5 ± 3.3
9	GGGUGUUCAC $\mathrm{A}$ $\mathrm{A}$G $\mathrm{A}$UAGAGUAG $\mathrm{A}$CU	1.4 + 0.2	92.3 ± 3.1
10	GCUUUGACAC $\mathrm{A}$ $\mathrm{A}$G $\mathrm{A}$UACAAUAU $\mathrm{A}$GU	36.4 ± 2.8	52.9 ± 1.7