Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Nucleotide sequences of the primers and TaqMan probes designed and used in this study
| Target gene | Name of primer or probea | Sequence (5′ → 3′) | Product size (bp) | Reference |
|---|---|---|---|---|
| phlD | 300phlD28 (F) | GAGCGAAGCCGGGAACAT | 73 | This study |
| 300phlD100 (R) | TACAGGCCCGCTGTCGAA | |||
| 300phlD52 (P) | CGTGGTGGTCTTCGACGT | |||
| hcnC | hcnCfwd423 (F) | CCTGCCCCAGTCGTTCTTT | 60 | 52 |
| hcnCrev482 (R) | TGCAACTGCGGATACATTGC | |||
| hcnC443 (P) | ATTTCGCCTTGCAGTCC |
F, forward; R, reverse; P, probe.
