Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequence of the oligonucleotides used in the study
| Used for | Primer | Primer sequence (5′ to 3′) | Amplicon size (bp) | Reference |
|---|---|---|---|---|
| MAMA PCR | 23s rRNA-Campy-1912F | AGTAAACGGCGGCCGTAAC | This study | |
| 23s rRNA-Campy-2074 N-Rev | GTAAAGGTCCACGGGGTCATT | 183 | This study | |
| 23s rRNA-Campy-2075 R | GTAAAGGTCCACGGGGTCAC | 183 | This study | |
| Sequencing | F2-Campy-23S | AATTGATGGGGTTAGCATTAGC | 552 | 21 |
| 2420R-Campy-23S | AGAACCACCGGATCACTAAGA | 10 |
