Skip to main content
. 2017 Jun 8;6:e24425. doi: 10.7554/eLife.24425

Figure 1. CypA promotes production of type I IFNs against virus infection.

(A) HA assays of SeV in 293T/CypA+ or 293T/CypA- cells infected with SeV (MOI = 1) for the indicated time periods. (B) TCID50 assays of proliferation level of VSV in 293T/CypA+ or 293T/CypA- cells infected with VSV (MOI = 1) for the indicated time periods. (C) Quantitative PCR analysis of SeV M mRNA in wild-type (WT) or CypA-deficient (Ppia−/−) BMDMs infected with SeV for the indicated time periods. (D) Luciferase activity of lysates in 293T/CypA+ or 293T/CypA- cells transfected for 24 hr with IFN-β luciferase reporter (IFN-β-Luc), together with Poly (I:C) (TpIC) or then treated with SeV, VSV, IAV-mut for 6 hr. (E) Quantitative PCR analysis of Ifnb1 and Ifna mRNA in WT or Ppia−/− BMDMs infected with SeV, VSV or IAV-mut for 6 hr. (F) ELISA of IFN-β and IFN-α production in the supernatants of WT or Ppia−/− BMDMs treated with SeV for 12 hr. (G) Quantitative PCR analysis of Ifit1, Ifit2, and Ccl5 mRNA in WT or Ppia−/− BMDMs treated with SeV for 6 hr. (H and I) Quantitative PCR analysis of IFNB1, IFNA (H) IFIT1, IFIT2, or CCL5 (I) mRNA in human monocytes transfected with CypA siRNA or scrambled siRNA for 48 hr and then treated with SeV for 6 hr. Data are shown as mean ± SD (A: n = 5; B-I: n = 3). *p<0.05, **p<0.01, ***p<0.001 (unpaired, two-tailed Student’s t-test). Data are from one representative of at least three independent experiments.

DOI: http://dx.doi.org/10.7554/eLife.24425.003

Figure 1—source data 1. Quantification of viral replication and type I IFN production for Figure 1.
DOI: http://dx.doi.org/10.7554/eLife.24425.004
elife-24425-fig1-data1.xls (2.2MB, xls)
DOI: 10.7554/eLife.24425.004

Figure 1.

Figure 1—figure supplement 1. Identification of Ppia-deficient mice.

Figure 1—figure supplement 1.

(A) PCR analysis of genomic DNA from tail tissue of Ppia-deficient mice. Water was used as a negative control for the PCR reaction. (B) Semi-quantitative analysis of Ppia mRNA in BMDMs from WT and Ppia−/− mice. Primers were designed to amplify Ppia or the housekeeping gene GAPDH (PCR primers: Ppia forward, 5′- ATGGTCAACCCCACCGTGTTC-3′; Ppia reverse, 5′- TTAGAGCTGTCCACAGTCGG-3′; GAPDH forward, 5’-ACCACAGTCCATGCCATCAC-3’; and GAPDH reverse, 5’- TCCACCACCCTGTTGCTGTA -3’). (C) Immunoblot analysis of lysates in WT and Ppia−/− BMDMs.
DOI: http://dx.doi.org/10.7554/eLife.24425.005
Figure 1—figure supplement 2. CypA promotes production of type I IFNs against virus infection in 293T, U937 cells and human monocytes.

Figure 1—figure supplement 2.

(A and B) Quantitative PCR analysis of IFNB1 (A), IFIT1, IFIT2, or CCL5 (B) mRNA in 293T/CypA+ and 293T/CypA- cells infected with SeV (MOI = 1) for 6 hr. (C) Immunoblot analysis of lysates in U937 or human primary monocytes transfected with CypA siRNA or scrambled siRNA for 48 hr. (D–G) Quantitative PCR analysis of IFNB1, IFNA (D and F) IFIT1, IFIT2, or CCL5 (E and G) mRNA in U937 cells transfected with CypA siRNA or scrambled siRNA for 48 hr and then treated with SeV (D and E) or VSV (F and G) for 6 hr. (H and I) Quantitative PCR analysis of IFNB1, IFNA (H) IFIT1, IFIT2, or CCL5 (I) mRNA in human monocyte cells transfected with CypA siRNA or scrambled siRNA for 48 hr and then treated with VSV for 6 hr. Data are shown as mean ± SD (n = 3). *p<0.05 and **p<0.01 (unpaired, two-tailed Student’s t-test). Data are representative of at least three independent experiments.
DOI: http://dx.doi.org/10.7554/eLife.24425.006
Figure 1—figure supplement 3. Effect of CypA on RIG-I-independent signaling.

Figure 1—figure supplement 3.

(A and B) Quantitative PCR analysis of IFNB1, IFIT1, IFIT2, CCL5 (A), or EMCV VP1 mRNA (B) in 293T/CypA+ and 293T/CypA- cells infected with EMCV (MOI = 0.5) for 6 hr. (C) Quantitative PCR analysis of Ifnb1 and Ifna mRNA in WT or Ppia−/− BMDMs cells infected with HSV-1 (MOI = 10) for 6 hr.
DOI: http://dx.doi.org/10.7554/eLife.24425.007
Figure 1—figure supplement 4. CypA is inducible against virus infection.

Figure 1—figure supplement 4.

(A) Quantitative PCR analysis of Ppia mRNA (top) and immunoblot analysis of CypA (below) in WT BMDMs treated with SeV, VSV, IAV-mut or IFN-β for the indicated time points. (B) Quantitative PCR analysis of PPIA mRNA (top) and immunoblot analysis of CypA (below) in 293T/CypA+ cells treated with SeV or transfected with Poly (I:C) for the indicated time points. (C and D) Quantitative PCR analysis of PPIA in U937 cells (C) or human monocytes (D) treated with SeV or VSV for 12 hr. Data are shown as mean ± SD (n = 3). *p<0.05 and **p<0.01 (unpaired, two-tailed Student’s t-test). Data are representative of at least three independent experiments.
DOI: http://dx.doi.org/10.7554/eLife.24425.008