Table 1.

qPCR primers and thermal cycling conditions used in this study

Target	Oligonucleotide sequence (5′-3′)a, b	Thermal profile	Number of cycles	References
16S rRNA gene total bacteria	GCCAGCAGCCGCGGTAAT (519F) CCGTCAATTCCTTTGAGTTT (907R)	94 °C 3 min 94 °C 30 s, 58 °C 30 s, 72 °C 30 s 72 °C 5 min Melt curve from 58 °C to 95 °C with increment 0.5 °C/10 s	1 35 1 1	519F (Lane 1991) 907R (Muyzer and Ramsing 1995)
bamA	GCAGTACAAYTCCTACACSACYGABATGGT (oah_F) CCRTGCTTSGGRCCVGCCTGVCCGAA (oah_R)	95 °C 5 min 95 °C 15 s, 58 °C 30 s, 72 °C 30 s 72 °C 10 min Melt curve from 58 °C to 95 °C with increment 0.5 °C/10 s	1 50 1 1	(Staats et al. 2011)
bssA	ACGACGGYGGCATTTCTC (bssA_F) GCATGATSGGYACCGACA (bssA_R) FAM CTTCTGGTTCTTCTGCACCTTGGACACC (bssA_probe)	95 °C 3 min 95 °C 15 s, 58 °C 60 s 72 °C 3 min	1 50 1	(Beller et al. 2002)
abcA	GCGGTGAGGTATTGACCACT (bc_F) TTCGGGCTGACATATCCTTC (bc_R)	95 °C 3 min 95 °C 30 s, 58 °C 30 s, 72 °C 60 s 72 °C 2 min Melt curve from 58 °C to 95 °C with increment 0.5 °C/10 s	1 40 1 1	This study
16S rRNA gene of Peptococcaceae	CCTTCGGGTAGACAGGGAGA (PeptoF) AGCCTCTCTAGAGTGCCCAA (PeptoR)	94 °C 3 min 94 °C 30 s, 60 °C 30 s, 72 °C 60 s 72 °C 2 min Melt curve from 60 °C to 95 °C with increment 0.5 °C/10 s	1 35 1 1	This study

^aPrimer names may not correspond to original publication

^bY = C or T; S = C or G; V = A or G or C; B = G or T or C; R = A or G