Table 2.

Primers and reaction profile for Mycoplasma/Ureaplasma spp. (van Kupperveld et al., 1992).

Primer	Target gene	Sequence (5′ → 3′)	Product (bp)
GPO-1	Mycoplasma genus-specific 16S rRNA	ACTCCTACGGGAGGCAGCAGTA	717
MGSO		TGCACCATCTGTCACTCTGTTAACCTC

Reaction profile: 1 cycle → 94°C for 1 min; 35 cycles → 94°C for 1 min, 55°C for 1 min and 72°C for 1 min; 1 cycle → 72°C for 5 min; 1 cycle → 0°C for ∞.