Table 1. PCR primers and PCR conditions of the amplified fragments of the detected viruses.
| Primer pair name/Virus a | Primers (5’-3’) | PCR conditions b | Expected Amplified region (bp) | Use |
|---|---|---|---|---|
| PPV2 | Forward: CAGCAGACTGGCGATTTATT;Reverse: TTTGACGTAACCACCAGGAT | 54/1.5 | 397 | PCR/Sequencing |
| PPV4 | Forward: TGGTTTTCCTGAGACTCCTG; Reverse: GTCGGCATTCTGTATTGTCC | 58/1.5 | 250 | PCR/Sequencing |
| PPV5 | Forward: AAGGGGAAATTGGTGAAAAG; Reverse: TATATGGCGCCCAAATGTAT | 54/1.5 | 351 | PCR/Sequencing |
| PPV6 | Forward: GACCTTCTGGACGGGTATTT; Reverse: TCAAGCCCTCTACACCAAAG | 58/1.5 | 383 | PCR/Sequencing |
| PBoV1-H18_317-616nt | Forward: GGTGAGTAACCATGCCTCTG; Reverse: GCGGTTTCAGCAAATATAGC | 58/1.5 | 270 | PCR/Sequencing |
| PBoV1-H18_1-316nt_317-616nt | Forward: GCACTCGCAGAAAGACTGTT; Reverse: CTTTCCGCATTCCTCTCTTT | 58/1.5 | 226 | PCR/Sequencing |
| PCV2_flank | Forward: AAGAATGGAAGAAGCGGACC; Reverse: CAAGGCTACCACAGTCACAA | 59/1.5 | 429 | PCR |
| PCV2_ovlp | Forward: CATTCAATGCAAGCGGTGTC; Reverse: CAAGGCTACCACAGTCACAA | 59/1.5 | 263 | PCR |
a Primers were built checking for conserved regions (if present) among the reference sequence and the different strains identified by using the refinement procedure adopted in the read mapping method. The following strains were used: PPV2—GenBank accession numbers: KP245947, GU938300, GU938301, KP765690, KC701309 and JX101461; PPV4—GenBank accession numbers: GQ387499 and GQ387500; PPV5—GenBank accession umbers: JX896319, JX896320 and JX896321; PPV6—GenBank accession: KF999682, KF999683, KF999684 and KF999685. Primers PBoV1-H18_317-616nt and PBoV1-H18_1-316nt_317-616nt were built based on the assembled sequence obtained by VirFind and on the reference sequence HQ291308. Primers PCV2_flank and PCV2_ovlp were built based on the assembled sequence obtained by VirFind and on the reference sequences KM259933 (truncated genome) and AY424401 (full genome adopted as reference).
b Annealing temperature (°C) / [MgCl2].