Table 2.

Primers pairs used for amplification of the cytochrome b gene fragment of Didymella rabiei and for detecting the G143A mutation.

Primers	Primer sequence (5′–3′)	Annealing temperature	Reference	Primer pair purpose
A99	TATTATGAGAGATGTAAATAATGG	46°C	Delgado et al., 2013	Sequencing of cytochrome b gene
A100	CCTAATAATTTATTAGGTATAGATCTTA	46°C	Delgado et al., 2013	Sequencing of cytochrome b gene
A243	GCTTTCCTGGGTTACGTTCT	64°C	This study	Multiplex TaqMan PCR
A244	CCAACTCATGGTATAGCACTCAT	64°C	This study	Multiplex TaqMan PCR
A245res	FAM-TGGGCAAATGTCACTATGAGCTGCTACAG-BHQ1	64° C	This study	QoI-resistant probe (A143 allele)
A246sens	Cy5-TGGGCAAATGTCACTATGAGGTGCTACAG-BBQ	64° C	This study	QoI-sensitive probe (G143 allele)