Figure 2.
Overexpression of PhapLFY in Phalaenopsis. (A) Plasmid construction for PhapLFY overexpression in Phalaenopsis orchids. pUbiq means maize ubiquitin promoter and T indicates nos terminator. RB and LB indicate right and left T-DNA borders. The hygromycin phosphotransferase II (hptII) expressing cassette was used for hygromycin resistance in selection of transgenic orchids. (B) Transgenic Phalaenopsis orchids overexpressing PhapLFY gene. Each transgenic orchid seedling used for analyses in C (left) and young orchid plantlets. Bar = 2cm. (C) Verification of transgenic Phalaenopsis orchids by genomic PCR and RT-PCR. Expression of PhapLFY and hygromycin resistance gene (hptII) was examined by RT-PCR together with 18s rRNA in leaves of each plant. The location of primers used for genomic PCR is parked in (A). P indicates plasmid DNA used for transformation as a positive control for PCR and WT indicates a non-transgenic Phalaenopsis orchid in the same developmental stage with transgenic orchids. JIT6: 5′TTGTCGATGCTCACCCTG3′, JIT841: 5′CTAGCCGCTCCTCTCTGTCTCCGAC3′, PhapLFY-F: 5′GAGGAGGAGGTGGACGATATGATG3′, PhapLFY-R: 5′GCTTGTTTATGTAGCTTGCTCCTAC3′, hptII-F: 5′GATTCCGGAAGTGCTTGACATTG3′, hptII-R: 5′GCATCAGCTCATCGAGAGCCTG3′, 18S rRNA-F: 5′TTAGGCCACGGAAGTTTGAGG3′, 18S rRNA-R: 5′ACACTTCACCGGACCATTCAA3′.