Skip to main content
The American Journal of Tropical Medicine and Hygiene logoLink to The American Journal of Tropical Medicine and Hygiene
. 2017 May 1;97(1):173–182. doi: 10.4269/ajtmh.16-0781

Performance of Real-Time Polymerase Chain Reaction Assays for the Detection of 20 Gastrointestinal Parasites in Clinical Samples from Senegal

Doudou Sow 1,2,*, Philippe Parola 2, Khadime Sylla 1, Magatte Ndiaye 1, Pascal Delaunay 3, Philippe Halfon 4, Sabine Camiade 4, Thérèse Dieng 1, Roger C K Tine 1, Babacar Faye 1, Jean Louis Ndiaye 1, Yémou Dieng 1, Oumar Gaye 1, Didier Raoult 2, Fadi Bittar 2
PMCID: PMC5508894  PMID: 28719290

Abstract.

Gastrointestinal parasite infections represent one of the biggest public health problems in the world. Therefore, appropriate innovative tools are needed for assessing interventions to control these infections. This study aims to compare the performance of real-time polymerase chain reaction (PCR) assays to microscopic examination for detection of intestinal parasites. A direct microscopic examination and stool concentration was performed on 98 stool samples from patients attending Senegalese hospitals. Negative microscopic control samples were also collected in Nice and Marseille (France). Species-specific primers/probes were used to detect 20 common gastrointestinal protozoans and helminths. Positive frequency and the sensitivity of each real-time PCR assay were compared with conventional microscopic examination. Real-time PCR was positive in 72 of 98 samples (73.5%), whereas microscopic examination was positive in 37 (37.7%) samples (P < 0.001). The real-time PCR assays were more sensitive than microscopy, with 57.4% (31/54) versus 18.5% (10/54), respectively, in the detection of parasites in asymptomatic patients (P < 0.05). In terms of polyparasitism, there were more coinfections detected by real-time PCR assays compared with microscopic methods (25.5% versus 3.06%). In comparison to parasite prevalence on individual samples, the results showed a perfect agreement (100%) between the two techniques for seven species, whereas discrepancies were observed for the others (agreement percentage varying from 64.2% to 98.9%). Real-time PCR appeared to be superior to microscopic examination for the detection of parasites in stool samples. This assay will be useful in diagnostic laboratories and in the field for evaluating the efficacy of mass drug administration programs.

INTRODUCTION

Infections due to gastrointestinal parasites represent one of the biggest public health problems in the world. According to the World Health Organization, more than 1 billion people are infected with nematodes that cause soil-transmitted helminthiases.1 Helminth and protozoan infections play major roles in the occurrence of the main digestive disorders causing morbidity and mortality worldwide.2 Among other problems, anemia, malnutrition, and gastrointestinal complaints, particularly diarrhea, are associated with these infections. Indeed, diarrheal diseases were responsible for more than 1.4 million deaths in 2010, ranking it the seventh leading cause of death to which children are most vulnerable.3 Unfortunately, these intestinal parasitic diseases are underestimated in limited-resource settings, particularly in Africa, due to the lack of sensitive and accurate diagnostic tools.

Microscopic examination of stool samples is the most widely used diagnostic approach for intestinal parasitic detection. First, direct microscopic examination is performed by mixing a small amount of feces with physiological sodium chloride solution (0.9%). Then, various stool concentration techniques based on the use of either sedimentation or flotation with a formalin-ether concentration technique are performed to increase sensitivity.46 Microscopic examination is not expensive and is able to screen for a maximum of parasites in one test, whereas molecular detection is limited to the targeted species. However, this microscopic diagnostic method lacks sensitivity and reproducibility, particularly in epidemiological investigation, and cannot distinguish species of some parasites based on their eggs such as Ancylostoma duodenale/Necator americanus or Taenia saginata/Taenia solium. Moreover, accurate diagnosis with microscopy depends on the experience of the laboratory’s microscopist and the concentration of parasite material in the sample. Finally, some parasite species such as Entamoeba histolytica, Cryptosporidium sp., and Strongyloides stercoralis, which are responsible for severe infections, are often misdiagnosed even when concentration techniques are used.7,8

To overcome these deficiencies, molecular techniques have been suggested as a complementary process and may be an alternative to microscopic examination. Indeed, conventional and real-time polymerase chain reaction (PCR) have proven to be sensitive and accurate for helminth and intestinal protozoan detection.9 These techniques have the advantage of detecting low parasite levels, improving the identification of infected persons, and assessing treatment effects by quantification.10 Moreover, a technician trained in PCR could run multiple tests to detect different classes of pathogens such as viruses, bacteria, and parasites. Real-time PCR is more attractive compared with conventional PCR, as the methodology reduces the risk of contamination and decreases the cost of reagents.8,11 To date, several real-time PCR assays have been developed separately to detect common helminths and intestinal protozoans.9 However, most of the studies assessing real-time PCR are limited to a small number of species.8,10,12

Given the need to control emerging and neglected tropical diseases, it is important to have innovative tools such as real-time PCR for accurate diagnoses. To do so, we need to assess the performance of real-time PCR assay in the detection of a maximum of intestinal parasites with the same protocols to avoid interlaboratory variations. That is why we have performed this study to compare the real-time PCR assay to microscopic examination for the detection of 20 gastrointestinal parasites in the same laboratory.

MATERIALS AND METHODS

Sample collection.

One hundred and three samples were collected between August and November 2014 from patients with or without abdominal symptoms in three hospitals (Fann teaching hospital, Roi Baudouin hospital of Guédiawaye and Dagana health center) in Senegal (a west African country). Feces were collected in appropriately sealed, labeled, and clean pots. The samples were collected in the laboratory, so the reading was done immediately or within 30 minutes. The stools received from hospitalized patients were transported on ice and examined within 1 hour. They were divided into two groups: positive and negative according to microscopy results. All slides were examined by two experienced microscopists. Due to discrepancies between the two reads, five specimens were removed from the analysis process. At the end, 98 fecal samples were further used for the study. After microscopic examination, all samples were fixed in absolute ethanol (96–100%) immediately after the concentration step, typically between 45 minutes and 1 hour after collection, and stored at 4°C before transportation to Marseille for molecular testing. Sociodemographic data (e.g., age, sex, and symptoms) for each sampled individual were also collected. Ninety-four microscopy-negative stool samples were collected as control in France, including 48 from Nice (Center Hospitalier Universitaire) and 46 from Marseille (Laboratoire Alphabio of Hôpital Européen). Stool samples were obtained from patients with or without symptoms, and who were received in these hospitals for parasitic infection diagnosis. Only specimens with negative microscopy results (no parasites identified after two readings by two microscopists) were tested by real-time PCR and compared with negative microscopy results from Senegal. The objective was to assess the performance of real-time PCR to detect parasites missed by microscopy in tropical and nontropical regions.

Microscopic examination.

Each sample collected in Senegal was first examined by direct saline solution, iodine mounts, and after concentration by the formol-ethyl acetate technique. Modified Ziehl–Neelsen staining was performed on direct fresh smears and on formol-ethyl acetate concentrates to detect Cryptosporidium, Cyclospora, and Cystoisospora species. For the identification of microsporidial spores, smears were prepared using concentrated sediment and stained with the modified trichrome method. A sample was considered negative if no parasite was identified after the examination of all fields on the prepared slide by the two readers. Samples from France were tested first in direct saline solution and after concentration with the routine method used by each laboratory. Trichrome staining was not performed in Marseille and Nice.

DNA extraction.

DNA was extracted from stool samples using a modified method of the Qiagen stool procedure (QIamp DNA Stool Mini Kit, Qiagen, Courtaboeuf, France).13,14 Aliquots of 200 mg (200 μL for liquid/diarrheic stools) of stool sample were placed in 2-mL tubes containing 200 mg of 2-mm glass beads and 1.5 mL of a stool lysis (ASL) buffer (Qiagen). The samples were mixed vigorously by agitation in a FastPrep BIO 101 agitator (Qbiogene, Strasbourg, France) at 3,200 rpm for 90 seconds, followed by heating at 95°C for 10 minutes. The final pellet was suspended in 200 μL of tissue lysis buffer and incubated with 30 μL of proteinase K for 2 hours at 55°C. Then, the manufacturer’s recommendations were followed for the purification and elution of the DNA. Inhibition was assessed for each sample by addition of an exogenous synthetic oligonucleotide and an internal control that was extracted and amplified. First, 70 μL of a synthetic sequence of 142 bp (5′-GCTACTGAGTCGTACCTAATGCATGACCTAGAGCACTCGACTGTTTATCAGTGTCGAGACTCGACGCATGCACGTACGAACCTAGCTGTCAGCAATCGCGAATGCCTACTAAGTAGCGAACTTTAGCGAATCGCGATACGAC-3′) routinely used in the laboratory and ordered at 200 nmol was diluted at 107 and was added in the tube containing the stool sample and the ASL buffer. The sequence was then amplified at the end of the extraction process in a real-time PCR assay by a set of primers (TissF_5′-CTGAGTCGTACCTAATGCATGACC-3′; TissR_5′-GTATCGCGATTCGCTAAAGTTC-3′) and probe (TissP_6FAM-5′-TCGAGACTCGACGCATGCACG-Tamra-3′). A second internal control consisting in the amplification of all bacteria in the stool sample by a simplex real-time PCR was used as described in the literature.15

Singleplex real-time PCR amplification and detection.

Twenty different specific primers and Taqman probes (hydrolysis probes) targeting sequences regions were used in multiparallel assays, including 17 published and three newly designed ones, as shown in Table 1. Specific primers/probes used for the first time in this study were designed using multiple sequence alignment ClustalW2 (EMBL-EBI, Cambridgeshire, UK) and the PRIMER 3 (Rozen S, Singapore) software. The specificity of each primer was tested using the basic local alignment search tool, available at the National Center for Biotechnology Information (http://blast.ncbi.nlm.nih.gov/).

Table 1.

List of primers and probes (Applied Biosystems, Cheshire, UK) used in this study for the detection of 20 intestinal parasites by real-time PCR

Parasites Name Primers/Probes Target region Reference
Protozoa
Balantidium coli BcoliF 5′-TGCAATGTGAATTGCAGAACC-3′ ITS-1 Designed in this study
BcoliR 5′-TGGTTACGCACACTGAAACAA-3′
BcoliP 5′-FAM-CTGGTTTAGCCAGTGCCAGTTGC-TAMRA-3′
Blastocystis spp. Blasto FWD F5 Blasto R F2 Blasto probe 5′-GGTCCGGTGAACACTTTGGATTT-3′ SSU rRNA gene 16
5′-CCTACGGAAACCTTGTTACGACTTCA-3′ 5′-FAM-TCGTGTAAATCTTACCATTTAGAGGA-MGBNFQ-3′
Cryptosporidium parvum; C. hominis 1PSF 5′-AACTTTAGCTCCAGTTGAGAAAGTACTC-3′ hsp70 gene 17
1PSR 5′-CATGGCTCTTTACCGTTAAAGAATTCC-3′
cryptP 5′-FAM-AATACGTGTAGAACCACCAACCAATACAACATC-TAMRA-3′
Cyclospora cayetanensis Cyclo250F 5′-TAGTAACCGAACGGATCGCATT-3′ 18s 18
Cyclo350R 5′-AATGCCACGTAGGCCAATA-3′
Cyclo281T 5′-FAM-CCGGCGATAGATCATTCAAGTTTCTGACC-TAMRA-3′
Dientamoeba fragilis Df-124F 5′-CAACGGATGTCTTGGCTCTTA-3′ 18S 19
Df-221R 5′-TGCATTCAAAGATCGAACTTATCAC-3′ 18S
Df-172revT 5′-FAM-CAATTCTAGCCGCTTAT-MGB-3′ 18S
Enterocytozoon bieneusi FEB1 5′-CGCTGTAGTTCCTGCAGTAAACTATGCC-3′ 18s 20
REB1 5′-CTTGCGAGCGTACTATCCCCAGAG-3′
PEB1 5′-FAM-ACGTGGGCGGGAGAAATCTTTAGTGTTCGGG-TAMRA-3′
Encephalitozoon intestinalis FEI1 5′-GCAAGGGAGGAATGGAACAGAACAG-3′ 18s 21
REI1 5′-CACGTTCAGAAGCCCATTACACAGC-3′
PEI1 5′-FAM-CGGGCGGCACGCGCACTACGATA-TAMRA-3′
Entamoeba histolytica Ehf 5′-AACAGTAATAGTTTCTTTGGTTAGTAAAA-3′ 18s 22
Ehr 5′-CTTAGAATGTCATTTCTCAATTCAT-3′
Ehp 5′-FAM-ATTAGTACAAAATGGCCAATTCATTCA-TAMRA-3′
Giardia lamblia (intestinalis or duodenalis) Giardia-80F 5′-GACGGCTCAGGACAACGGTT-3′ 18s 23
Giardia-127R 5′-TTGCCAGCGGTGTCCG-3′
Giardia-105T 5′-FAM-CCCGCGGCGGTCCCTGCTAG-TAMRA-3′
Cystoisospora belli Ib-40F 5′-ATATTCCCTGCAGCATGTCTGTTT-3′ ITS2 24
Ib-129R 5′-CCACACGCGTATTCCAGAGA-3′
Ib-81Taq 5′-FAM-CAAGTTCTGCTCACGCGCTTCTGG-TAMRA-3′
Helminths
Ancylostoma duodenale Ad125F 5′-GAATGACAGCAAACTCGTTGTTG-3′ ITS2 25
Ad195R 5′-ATACTAGCCACTGCCGAAACGT-3′
Ad155-XS 5′-FAM-ATCGTTTACCGACTTTAG-MGB-3′
Ascaris lumbricoides Alum96F 5′-GTAATAGCAGTCGGCGGTTTCTT-3′ ITS-1 26
Alum183R 5′-GCCCAACATGCCACCTATTC-3′
Alum124T 5′-FAM-TTGGCGGACAATTGCATGCGAT-TAMRA-3′
Hymenolepis diminuta HymF 5′-GTTGTATCAGGGAGTGGTG-3′ ITS-1 Designed in this study
HymR 5′-AATTCACATCTCGTGCCTTG-3′
HymP 5′-FAM-TGCTGCAGTTCACTAACCGTGGC-TAMRA-3′
Necator americanus Na58F 5′-CTGTTTGTCGAACGGTACTTGC-3′ ITS-2 25
Na158R 5′-ATAACAGCGTGCACATGTTGC-3′
Na81Tmgb 5′-FAM-CTGTACTACGCATTGTATAC-MGB-3′
Schistosoma mansoni SRA1 5′-CCACGCTCTCGCAAATAATCT-3′ Tandem repeat units M61098 27
SRS2 5′-CAACCGTTCTATGAAAATCGTTGT-3′
SRP 5′-FAM-TCCGAAACCACTGGACGGATTTTTATGAT-TAMRA-3′
Strongyloides stercoralis Stro-1530F 5′-GAATTCCAAGTAAACGTAAGTCATTAGC-3′ 18s 28
Stro-1630R 5′-TGCCTCTGGATATTGCTCAGTTC-3′
Stro-1586T 5′FAM-ACACACCGGCCGTCGCTGC-TAMRA-3′
Taenia solium Tsol_ 145F 5′ATGGATCAATCTGGGTGGAGTT-3′ ITS 29
Tsol_ 230R 5′-ATCGCAGGGTAAGAAAAGAAGGT-3′
Tsol_169Tq 5′-FAM-TGGTACTGCTGTGGCGGCGG-TAMRA-3′
Taenia saginata Tsag_F529 5′-GCGTCGTCTTTGCGTTACAC-3′ ITS 29
Tsag_R607 5′-TGACACAACCGCGCTCTG-3′
Tsag_581Tq 5′-FAM-CCACAGCACCAGCGACAGCAGCAA-TAMRA-3′
Trichuris trichiura TrichF 5′-TTGAAACGACTTGCTCATCAACTT-3′ 18s 30
TrichR 5′-CTGATTCTCCGTTAACCGTTGTC-3′
TrichP 5′-FAM-CGATGGTACGCTACGTGCTTACCATGG-TAMRA-3′
Enterobius vermicularis EnterF 5′-TTTCCAAGCCACAGACTCAC-3′ 5S rRNA region Designed in this study
EnterR 5′-ATTGCTCGTTTGCCGATTAT-3′
EnterP 5′-FAM-TCATGTCTGAGCCGGAACGAGA-TAMRA-3′

PCR = polymerase chain reaction.

All primers and probes used in the study were assessed for analytical sensitivity and specificity. To determine the limit of detection, plasmids with each specific target sequence were diluted to a fixed concentration and serially diluted to a final concentration of 10 copies/5 μL. For the analytical specificity, each species-specific assay was tested against other parasite DNA preparations to detect any cross-reactivity.

The real-time PCR reactions were conducted using 20 μL total volumes containing 10 μL of master mix (Quantitect; Qiagen), 0.5 μL of each primer (20 μM), 2 μL of probes (3 μM), 2 μL of distilled water, and 5 μL of template DNA. Analyses were performed using a CFX96 Real-Time PCR detection assay (Bio-Rad Life Science, Marnes-la-Coquette, France). Amplification reactions were done as follows: 95°C for 15 minutes followed by 44 cycles of 60°C for 0.5 minutes and 72°C for 1 minute. Positive (parasite-specific oligonucleotides) and negative controls were tested in each run.

The real-time PCR assays were carried out in duplicate for reproducibility. During the first assay, samples were run without using positive control to avoid any possible contamination with the plasmid DNA. In a second assay, all samples including positive and negative ones from the first run were tested again with plasmid control DNA launched in parallel to validate the negative results. Real-time PCR results were considered negative when the Ct value was more than 38 or no amplification curve was obtained. The limit of the detection was set at cycle 38 because for some parasites, previous studies have reported amplification until cycle 37.10 For those without information on the limit of detection, late amplification of the 10-fold diluted plasmids showed the threshold around cycle 36–37. All the samples above cycle 35 were retested from the initial eluate to confirm the result.

Data analysis.

The data were entered into Excel TM and analyzed with the TM R2.15.0 software (R Foundation for Statistical Computing, Vienna, Austria). Qualitative variables were described in terms of numbers, percentage of data provided, and quantitative data in terms of means with standard deviation. Statistical comparisons were made using the χ2 test or Fisher’s test depending on the conditions of applicability. The test was considered significant if the P value was less than 0.05. Cases were defined as patients experiencing gastrointestinal symptoms including diarrhea (three or more loose or liquid stools per day), abdominal pain, gastroenteritis syndrome (diarrhea + vomiting), pruritus, and dysenteric syndrome. Patients without gastrointestinal symptoms were considered as controls. When comparing the techniques, total agreement statistics (in percent) were calculated as well as the kappa coefficient in the case of discrepancies between the two methods. The kappa agreement level was interpreted as follows: κ < 0.20 Poor, 0.21–0.40 Fair, 0.41–0.60 Moderate, 0.61–0.80 Good, and 0.81–1.00 Very Good.31

Ethics statement.

All aspects of this study were approved by the National Ethical Committee of Senegal (agreement no. 00000121-MSAS/DPRS/CNERS). Written informed consent was not obtained from patients in this study because it is not necessary for stool sample collection according to local laws and regulations in Senegal and France. However, oral consent was obtained from patients, including parents on behalf of children and patient medical data were anonymized. Patients were treated according to microscopic results.

RESULTS

Patients, microscopic examination, and real-time PCR results.

Overall, 103 stool samples were collected from patients attending health facilities, but 98 were retained in the analysis process. The baseline characteristics of patients enrolled are summarized in Table 2.

Table 2.

Baseline characteristics of enrolled patients from Senegal

Number Percentage 95% CI
Age
 Under 5 years 5 5.1 1.6–11.5
 5–15 years 10 10.2 5–17.9
 16–25 years 35 35.7 26.2–46.03
 26–35 years 27 27.5 19.01–37.5
 36–45 years 10 10.2 5–17.9
 Over 45 years 11 11.2 5.7–19.2
Gender
 Male 51 52.04 41.7–62.2
 Female 47 47.9 37.7–58.2
Gastrointestinal symptoms
 Yes 44 44.9 34.8–55.2
 No 54 55.1 44.7–65.1
Signs
 Diarrhea 16 16.3 9.6–25.1
 Abdominal pain 19 19.3 12.1–28.6
 Gastroenteritis 7 7.1 2.9–14.1
 Pruritus 1 1.02 0.03–5.5
 Dysenteric syndrome 1 1.02 0.03–5.5
Microscopic results
 Positive 37 37.7 28.1–48.1
 Negative 61 62.2 51.8–71.8
Real-time PCR results
 Positive 72 73.5 63.5–81.8
 Negative 26 26.5 18.1–36.4

CI = confidence interval; PCR = polymerase chain reaction.

The age of patients varied from 1 to 76 years along with a mean age at 26.4 ± 15.2 years. There were 44 (44.9%) patients with gastrointestinal symptoms. The most common clinical signs were diarrhea (16.3%) and abdominal pain (19.3%). Patients with gastrointestinal symptoms were considered as cases and patients without these symptoms as control.

Microscopic examinations yielded 37 (37.7%) positive cases and 61 (62.2%) negative cases. The different coinfections identified by microscopic methods and real-time PCR are summarized in Table 3. In real-time PCR assays, all negative controls run along with samples yielded negative results after testing. Plasmid DNAs used as positive controls allowed us to validate the primers and probes for parasites presenting negative results in all clinical samples. All primers/probes were specific to its respective parasite. There was no amplification of target genomic DNA from the other parasites. Overall, 72 (73.5%) clinical samples were positive with real-time PCR including single and multiple infections as shown in Table 3.

Table 3.

Presentation of coinfections identified by microscopic examination and real-time PCR assays

Number
Microscopic examination
Ascaris lumbricoides + Trichuris trichiura 2
A. lumbricoides + Entamoeba histolytica 1
Real-time PCR assays
A. lumbricoides + Strongyloides stercoralis + Blastocystis spp. 1
A. lumbricoides + Trichuris trichiura 1
A. lumbricoides + Trichuris trichiura + Blastocystis spp. 1
A. lumbricoides + Trichuris trichiura + Blastocystis spp. +  Giardia intestinalis 1
A. lumbricoides + Blastocystis spp. 3
A. lumbricoides + Enterocytozoon bieneusi 1
Ancylostoma duodenale + Schistosoma mansoni 1
Blastocystis spp. + Dientamoeba fragilis 3
Blastocystis spp. + Taenia saginata 1
E. histolytica + Blastocystis spp. 1
G. intestinalis + Enterocytozoon bieneusi 1
G. intestinalis + Blastocystis spp. 2
G. intestinalis + E. histolytica + Blastocystis spp. 1
G. intestinalis + Necator americanus + Blastocystis spp. 1
G. intestinalis + T. saginata + Blastocystis spp. 1
Cystoisospora belli + Blastocystis spp. 1
Cystoisospora belli + Cyclospora cayetanensis 1
S. stercoralis + Blastocystis spp. 1
T. saginata + Blastocystis spp. 1
Trichuris trichiura + S. stercoralis 1

PCR = polymerase chain reaction.

Comparison of real-time PCR with microscopy.

The overall positive rate was 73.5% (72/98) in real-time PCR assay versus 37.7% (37/98) in microscopy methods (P < 0.001). Both techniques detected more parasites in the “cases” group than in the “control” group (P < 0.05), as shown in Figure 1. However, the real-time PCR assay was more sensitive than microscopy for parasite detection in patients without gastrointestinal symptoms (P < 0.05) with a sensitivity of 57.4% (31/54) versus 18.5% (10/54), respectively. In terms of polyparasitism, the real-time PCR assay was able to detect more coinfections than microscopy methods (25.5% versus 3.06%), as shown in Figure 1. Most of these coinfections (19/25) consisted of two parasites, with three parasites in five cases and four parasites in one case as shown in Table 3. In the protozoa group, Blastocystis hominis and Giardia intestinalis were the most commonly detected species by both methods followed by E. histolytica (Table 4). Dientamoeba fragilis was detected only by real-time PCR and most cases (3/4) were observed in patients without gastrointestinal symptoms. Cyclospora cayetanensis was also detected only by real-time PCR. No cases of Encephalocytozoon intestinalis were detected by either technique. As shown in Table 4, the real-time PCR assay yielded greater detection rates than microscopy in the identification of protozoan species except for Cryptosporidium sp. (similar results).

Figure 1.

Figure 1.

Overall comparison of real-time polymerase chain reaction (PCR) vs. microscopy. This figure appears in color at www.ajtmh.org.

Table 4.

Comparison of real-time PCR vs. microscopy in the detection of protozoa and helminths in stool samples

Real-time PCR n (%)
Microscopy n (%)
Total agreement* (%) Kappa
Total N = 98 Cases N = 44 Control N = 54 Total N = 98 Cases N = 44 Control N = 54
Protozoa
Balantidium coli 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Blastocystis spp. 47 (47.9) 23 (52.2) 24 (44.4) 12 (12.2) 7 (15.9) 5 (9.2) 63 (64.2) 0.26
Cryptosporidium sp. 1 (1.02) 1 (2.2) 0 (0) 1 (1.02) 1 (2.2) 0 (0)
Cyclospora cayetanensis 1 (1.02) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 97 (98.9) 0
Dientamoeba fragilis 4 (4.08) 1 (2.2) 3 (5.5) 0 (0) 0 (0) 0 (0) 94 (95.9) 0
Encephalocytozoon intestinalis 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Enterocytozoon bieneusi 2 (2.04) 2 (4.5) 0 (0) 0 (0) 0 (0) 0 (0) 96 (97.9) 0
Entamoeba histolytica 4 (4.08) 2 (4.5) 2 (3.7) 3 (3.06) 2 (4.5) 1 (1.8) 93 (94) 0.14
Giardia intestinalis 12 (12.2) 8 (18.1) 4 (7.4) 7 (7.1) 5 (11.3) 2 (3.7) 91 (92.8) 0.55
Cystoisospora belli 3 (3.06) 2 (4.5) 1 (1.8) 1 (1.02) 1 (2.2) 0 (0) 96 (97.9) 0.40
Helminths
Ancylostoma duodenale 1 (1.02) 0 (0) 1 (1.8) 0 (0) 0 (0) 0 (0) 97 (98.9) 0
Ascaris lumbricoides 12 (12.2) 11 (25) 1 (1.8) 10 (10.2) 9 (20.4) 1 (1.8) 96 (97.9) 0.85
Enterobius vermicularis 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Hymenolepis diminuta 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Necator americanus 1 (1.02) 1 (2.2) 0 (0) 0 (0) 0 (0) 0 (0) 97 (98.9) 0
Strongyloides stercoralis 3 (3.06) 2 (4.5) 1 (1.8) 0 (0) 0 (0) 0 (0) 95 (96.9) 0
Schistosoma mansoni 1 (1.02) 0 (0) 1 (1.8) 1 (1.02) 0 (0) 1 (1.8)
Taenia saginata 4 (4.08) 1 (2.2) 3 (5.5) 1 (1.02) 1 (2.2) 0 (0) 95 (96.9) 0.33
Taenia solium 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)
Trichuris trichiura 8 (8.1) 7 (15.9) 1 (1.8) 4 (4.08) 4 (9.09) 0 (0) 94 (95.9) 0.58

PCR = polymerase chain reaction.

*

Total agreement is calculated by the sum of true positive and true negative cases (confirmed by both techniques) divided by the total number of patients.

In the helminths group, the real-time PCR assay was also more sensitive than microscopy in the detection of species as described in Table 4, except for Schistosoma mansoni where the two methods gave similar results. Hookworm species (Ancylostoma duodenale and N. americanus) and S. stercoralis were only detected by real-time PCR. There was no case of T. solium. In Cestoda, the number of T. saginata detected (3/54) was greater in patients without any gastrointestinal symptoms than in the “case” group (1/44).

Performance level of the two methods.

By comparing the two methods, the agreement was perfect (100%) between real-time PCR and microscopy in the identification of Balantidium coli, Cryptosporidium sp., Encephalitozoon intestinalis, Enterobius vermicularis, Hymenolepis diminuta, Schistosoma mansoni, and T. solium; however, total agreement between the two methods varied from 64.2% to 98.9% for the other species with discrepant results as described in Table 4.

To assess the sensitivity of this molecular method in nonendemic regions, we compared the performance of the real-time PCR assay in detecting intestinal parasites in the microscopy-negative samples from Senegal with microscopy-negative samples collected from Nice and Marseille in France as described in Table 5. The number of positive cases by real-time PCR was greater among microscopy-negative specimens from Senegal (60.6%). However, the assay allowed us to detect parasites in 15 of 46 patients from Marseille (32.6%) and nine of 48 patients from Nice (18.7%). Blastocystis spp. was the most frequently species detected in these samples.

Table 5.

Comparison of the performance of real-time PCR for the detection of parasites in microscopy negative samples from Senegal and negative controls from France

No. of real-time PCR positive cases/total microscopy-negative samples (%) Senegal N = 61 France N = 94
37/61 (60.6%) 24/94 (25.5%)
Protozoa
Balantidium coli 0 0
Blastocystis spp. 24 19
Cryptosporidium sp. 0 1
Cyclospora cayetanensis 1 0
Dientamoeba fragilis 2 1
Encephalocytozoon intestinalis 0 0
Enterocytozoon bieneusi 1 1
Entamoeba histolytica 2 3
Giardia intestinalis 5 0
Cystoisospora belli 2 0
Helminths
Ancylostoma duodenale 1 0
Ascaris lumbricoides 2 1
Enterobius vermicularis 0 0
Hymenolepis diminuta 0 0
Necator americanus 1 0
Strongyloides stercoralis 3 2
Schistosoma mansoni 0 0
Taenia saginata 3 0
Taenia solium 0 0
Trichuris trichiura 4 1

PCR = polymerase chain reaction.

DISCUSSION

Many real-time PCR assays for the detection of intestinal parasites have been developed to date, particularly those based on multiplex systems. Among these, the available commercial kits detect only three or four parasites along with other pathogens.3238 In this study, we assessed the performance of a multiparallel real-time PCR assay compared with microscopic methods for the detection of 20 gastrointestinal parasites including protozoa and helminths. The large number of real-time PCR assays tested in this study demonstrated the ability to detect an important number of parasites without technical expertise in parasitology.

The high positivity rate in this study observed with real-time PCR assays compared with microscopy confirms the results of previous studies showing the superiority of real-time PCR in the detection of intestinal parasites.810 Moreover, a similar molecular study conducted recently in the United States, using stool samples collected from western Kenya, has demonstrated that some parasites including Ascaris lumbricoides and N. americanus can be detected by real-time PCR with a high sensitivity rate (98% for both parasites) compared with microscopy (70 and 32%, respectively).39 Furthermore, the real-time PCR assay applied in our study showed a significantly higher sensitivity rate compared with microscopy in the detection of parasites in asymptomatic patients. This can be explained by the ability of the real-time PCR assay to detect low DNA copy numbers in samples with low egg counts, with as few as 10 copies for some parasite species or 0.013 ng/μL.39 Another explanation may be the real-time PCR’s ability to detect DNA at any lifecycle stage (e.g., larvae), whereas identification by microscopy is optimized for a single stage.10 This aspect will be useful in the control of these infections, which are considered to be neglected tropical diseases, either by identifying the reservoir or assessing both the level of transmission and the efficiency of deworming programs. Interestingly, Easton and others have showed that the prevalence of many parasites detected by real-time PCR remains higher than that detected by microscopy even after treatment,39 demonstrating its benefit for low-level parasite detection after antiparasitic therapy. Moreover, the limit of detection and species specificity of detection can be improved by using next-generation sequencing to design assays that target noncoding, high-copy-number repetitive sequences as described by Pilotte and others.40

Another finding is the relatively high level of parasitic coinfections detected by real-time PCR compared with microscopy in this study. This finding is interesting as polyparasitism represents an important factor in the process of selecting antiparasitic drugs for mass drug administration.10,41 Coinfections between helminths and protozoa observed in this study emphasized the need to target some parasites such as G. intestinalis in mass drug administration programs, which are currently directed at soil-transmitted helminths.10

Among protozoan species observed in this study, Blastocystis spp. and G. intestinalis were the most common parasites detected by both methods. The first one, Blastocystis spp., was detected at a high rate (47.9%) in this study. These high rates of Blastocystis have already been reported in rural areas of Senegal where the authors describe a very high prevalence of up to 100%.42 This high rate has never been reported elsewhere according to the authors. The high prevalence of this parasite in the gut continues to raise real questions about its pathogenicity. For G. intestinalis, the results obtained in this study agree with previously reported data describing this parasite as one of the most common protozoan pathogens in Senegal.43 The remaining protozoans were detected at different percentages according to the method used. Among them, we noted a high rate of D. fragilis in asymptomatic patients. The pathogenicity of this parasite has been controversial since its discovery. However, many studies have linked this parasite to the occurrence of gastrointestinal symptoms, especially in children.9,44 Therefore, introducing molecular methods for detecting this small protozoan will be useful in monitoring it.

In the diagnosis of helminths, both methods were able to easily detect A. lumbricoides, Trichuris trichiura, and Schistosoma mansoni with little difference observed in terms of sensitivity, as diagnosis appears to be simple (except at low concentration) compared with the difficult microscopic detection of protozoan species.9 However, the real-time PCR assay was only able to detect hookworm species and S. stercoralis. This result could be explained by the fact that no specific concentration techniques were used for the identification of Strongyloides larvae in this study. Indeed, diagnosis of hookworm and S. stercoralis infection is difficult due to the small numbers of ova and larvae available in the feces.9 Therefore, multiple stools should be tested and sometimes specific concentration techniques, such as the Baermann method, are necessary to increase the sensitivity rate.45 Unfortunately, these methods are not always used in routine diagnosis and are not available in the field for surveys, leading to the underestimation of infections during epidemiological investigations. Thus, real-time PCR assays seem to be a suitable method for assessing the burden of parasitic infections and the efficacy of ongoing mass deworming programs in the field during epidemiological surveys.

The multiparallel real-time PCR assays tested in this study allowed the detection of 20 gastrointestinal parasites with the same standard operating procedures. However, the time and the cost needed to test 20 parasites per sample can be a limitation in the future. For example, based on the costs of reagents (without DNA extraction and without equipment and labor costs), we estimated that real-time PCR identification (total volume of 20 μL) costs approximately 2€ per parasite and per run (8€ to run four PCRs). So, multiplexing different target DNA offers savings in terms of costs as the reagent costs can be decreased from 8 to 2,18€ by testing four parasites in one PCR run. It can also offer savings in terms of labor time as reported by Liewellyn and others.31 Studies to assess the performance of real-time PCR for multiple targets (four to five parasites) in the same run are planned in the near future.

The increased sensitivity of real-time PCR in the detection of parasites in samples from Senegal was also confirmed by the results obtained from Marseille and Nice. The identification of parasites in patients with negative results in microscopy has demonstrated the superiority of real-time PCR compared with microscopy even in regions with a low prevalence of parasitic infections. Most of the parasites detected were protozoa, particularly Blastocystis spp. which is described as very difficult to identify by microscopic methods. There was also one case of Cryptosporidium sp., one case of Enterocytozoon bieneusi, and one case of D. fragilis in the control group. It is worthy to note that we did not use herein a permanent stained slide, which is particularly important for detecting certain protozoan parasites, such as D. fragilis and B. hominis, by microscopic examination. This could explain the superiority of the molecular assays in identifying these parasites in control groups.

Despite the high sensitivity rate observed with real-time PCR assay, the traditional parasitological diagnosis using microscopic tools remains an important method due to its low cost, particularly in endemic low-resource settings, and due to its ability to detect pathogens that are not targeted in the specific real-time PCR assay.

In conclusion, the real-time PCR assay described in this study appears to be a promising tool for diagnosing parasitic infections in laboratories and in the field when evaluating the efficacy of mass drug administration programs currently implemented in many resource-poor settings.

Disclaimer: The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

REFERENCES

  • 1.World Health Organization , 2012. Accelerating Work to Overcome the Global Impact of Neglected Tropical Diseases: A Roadmap for Implementation. Available at: http://apps.who.int/iris/bitstream/10665/70809/1/WHO_HTM_NTD_2012.1_eng.pdf. Accessed July 24, 2015.
  • 2.Becker SL, Vogt J, Knopp S, Panning M, Warhurst DC, Polman K, Marti H, von Müller L, Yansouni CP, Jacobs J, Bottieau E, Sacko M, Rijal S, Meyanti F, Miles MA, Boelaert M, Lutumba P, van Lieshout L, N’Goran EK, Chappuis F, Utzinger J, 2013. Persistent digestive disorders in the tropics: causative infectious pathogens and reference diagnostic tests. BMC Infect Dis 13: 37. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lozano R, Naghavi M, Foreman K, Lim S, Shibuya K, Aboyans V, Abraham J, Adair T, Aggarwal R, Ahn SY, AlMazroa MA, Alvarado M, Anderson HR, Anderson LM, Andrews KG, Atkinson C, Baddour LM, Barker-Collo S, Bartels DH, Bell ML, Benjamin EJ, Bennett D, Bhalla K, Bikbov B, Abdulhak AB, Birbeck G, Blyth F, Bolliger I, Boufous S, Bucello C, Burch M, Burney P, Carapetis J, Chen H, Chou D, Chugh SS, Coffeng LE, Colan SD, Colquhoun S, Colson KE, Condon J, Connor MD, Cooper LT, Corriere M, Cortinovis M, de Vaccaro KC, Couser W, Cowie BC, Criqui MH, Cross M, Dabhadkar KC, Dahodwala N, De Leo D, Degenhardt L, Delossantos A, Denenberg J, Des Jarlais DC, Dharmaratne SD, Dorsey ER, Driscoll T, Duber H, Ebel B, Erwin PJ, Espindola P, Ezzati M, Feigin V, Flaxman AD, Forouzanfar MH, Fowkes FGR, Franklin R, Fransen M, Freeman MK, Gabriel SE, Gakidou E, Gaspari F, Gillum RF, Gonzalez-Medina D, Halasa YA, Haring D, Harrison JE, Havmoeller R, Hay RJ, Hoen B, Hotez PJ, Hoy D, Jacobsen KH, James SL, Jasrasaria R, Jayaraman S, Johns N, Karthikeyan G, Kassebaum N, Keren A, Khoo J-P, Knowlton LM, Kobusingye O, Koranteng A, Krishnamurthi R, Lipnick M, Lipshultz SE, Ohno SL, Mabweijano J, MacIntyre MF, Mallinger L, March L, Marks GB, Marks R, Matsumori A, Matzopoulos R, Mayosi BM, McAnulty JH, McDermott MM, McGrath J, Mensah GA, Merriman TR, Michaud C, Miller M, Miller TR, Mock C, Mocumbi AO, Mokdad AA, Moran A, Mulholland K, Nair MN, Naldi L, Narayan KM, Nasseri K, Norman P, O`Donnell M, Omer SB, Ortblad K, Osborne R, Ozgediz D, Pahari B, Pandian JD, Rivero AP, Padilla RP, Perez-Ruiz F, Perico N, Phillips D, Pierce K, Pope CA, 3rd, Porrini E, Pourmalek F, Raju M, Ranganathan D, Rehm JT, Rein DB, Remuzzi G, Rivara FP, Roberts T, De León FR, Rosenfeld LC, Rushton L, Sacco RL, Salomon JA, Sampson U, Sanman E, Schwebel DC, Segui-Gomez M, Shepard DS, Singh D, Singleton J, Sliwa K, Smith E, Steer A, Taylor JA, Thomas B, Tleyjeh IM, Towbin JA, Truelsen T, Undurraga EA, Venketasubramanian N, Vijayakumar L, Vos T, Wagner GR, Wang M, Wang W, Watt K, Weinstock MA, Weintraub R, Wilkinson JD, Woolf AD, Wulf S, Yeh PH, Yip P, Zabetian A, Zheng ZJ, Lopez AD, Murray CJ, AlMazroa MA, Memish ZA, 2012. Global and regional mortality from 235 causes of death for 20 age groups in 1990 and 2010: a systematic analysis for the Global Burden of Disease Study 2010. Lancet 380: 2095–2128. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Allen AV, Ridley DS, 1970. Further observations on the formol-ether concentration technique for faecal parasites. J Clin Pathol 23: 545–546. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5.Utzinger J, Botero-Kleiven S, Castelli F, Chiodini PL, Edwards H, Köhler N, Gulletta M, Lebbad M, Manser M, Matthys B, N’Goran EK, Tannich E, Vounatsou P, Marti H, 2010. Microscopic diagnosis of sodium acetate-acetic acid-formalin-fixed stool samples for helminths and intestinal protozoa: a comparison among European reference laboratories. Clin Microbiol Infect 16: 267–273. [DOI] [PubMed] [Google Scholar]
  • 6.Becker SL, Lohourignon LK, Speich B, Rinaldi L, Knopp S, N’Goran EK, Cringoli G, Utzinger J, 2011. Comparison of the Flotac-400 dual technique and the formalin-ether concentration technique for diagnosis of human intestinal protozoon infection. J Clin Microbiol 49: 2183–2190. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Saugar JM, Merino FJ, Martín-Rabadán P, Fernández-Soto P, Ortega S, Gárate T, Rodríguez E, 2015. Application of real-time PCR for the detection of Strongyloides spp. in clinical samples in a reference center in Spain. Acta Trop 142: 20–25. [DOI] [PubMed] [Google Scholar]
  • 8.Nazeer JT, El Sayed Khalifa K, von Thien H, El-Sibaei MM, Abdel-Hamid MY, Tawfik RAS, Tannich E, 2013. Use of multiplex real-time PCR for detection of common diarrhea causing protozoan parasites in Egypt. Parasitol Res 112: 595–601. [DOI] [PubMed] [Google Scholar]
  • 9.Verweij JJ, Stensvold CR, 2014. Molecular testing for clinical diagnosis and epidemiological investigations of intestinal parasitic infections. Clin Microbiol Rev 27: 371–418. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mejia R, Vicuna Y, Broncano N, Sandoval C, Vaca M, Chico M, Cooper PJ, Nutman TB, 2013. A novel, multi-parallel, real-time polymerase chain reaction approach for eight gastrointestinal parasites provides improved diagnostic capabilities to resource-limited at-risk populations. Am J Trop Med Hyg 88: 1041–1047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Klein D, 2002. Quantification using real-time PCR technology: applications and limitations. Trends Mol Med 8: 257–260. [DOI] [PubMed] [Google Scholar]
  • 12.Basuni M, Muhi J, Othman N, Verweij JJ, Ahmad M, Miswan N, Rahumatullah A, Aziz FA, Zainudin NS, Noordin R, 2011. A pentaplex real-time polymerase chain reaction assay for detection of four species of soil-transmitted helminths. Am J Trop Med Hyg 84: 338–343. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Hamad I, Sokhna C, Raoult D, Bittar F, 2012. Molecular detection of eukaryotes in a single human stool sample from Senegal. PLoS One 7: e40888. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 14.Hamad I, Delaporte E, Raoult D, Bittar F, 2014. Detection of termites and other insects consumed by African great apes using molecular fecal analysis. Sci Rep 4: 4478. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Dridi B, Henry M, El Khéchine A, Raoult D, Drancourt M, 2009. High prevalence of Methanobrevibacter smithii and Methanosphaera stadtmanae detected in the human gut using an improved DNA detection protocol. PLoS One 4: e7063. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Stensvold CR, Ahmed UN, Andersen LO, Nielsen HV, 2012. Development and evaluation of a genus-specific, probe-based, internal-process-controlled real-time PCR assay for sensitive and specific detection of Blastocystis spp. J Clin Microbiol 50: 1847–1851. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17.Garcés-Sanchez G, Wilderer PA, Munch JC, Horn H, Lebuhn M, 2009. Evaluation of two methods for quantification of hsp70 mRNA from the waterborne pathogen Cryptosporidium parvum by reverse transcription real-time PCR in environmental samples. Water Res 43: 2669–2678. [DOI] [PubMed] [Google Scholar]
  • 18.Verweij JJ, Laeijendecker D, Brienen EAT, van Lieshout L, Polderman AM, 2003. Detection of Cyclospora cayetanensis in travellers returning from the tropics and subtropics using microscopy and real-time PCR. Int J Med Microbiol 293: 199–202. [DOI] [PubMed] [Google Scholar]
  • 19.Verweij JJ, Mulder B, Poell B, van Middelkoop D, Brienen EAT, van Lieshout L, 2007. Real-time PCR for the detection of Dientamoeba fragilis in fecal samples. Mol Cell Probes 21: 400–404. [DOI] [PubMed] [Google Scholar]
  • 20.Menotti J, Cassinat B, Porcher R, Sarfati C, Derouin F, Molina J, 2003. Development of a real-time polymerase-chain-reaction assay for quantitative detection of Enterocytozoon bieneusi DNA in stool specimens from immunocompromised patients with intestinal microsporidiosis. J Infect Dis 187: 1469–1474. [DOI] [PubMed] [Google Scholar]
  • 21.Menotti J, Cassinat B, Sarfati C, Liguory O, Derouin F, Molina J-M, 2003. Development of a real-time PCR assay for quantitative detection of Encephalitozoon intestinalis DNA. J Clin Microbiol 41: 1410–1413. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Roy S, Kabir M, Mondal D, Ali IKM, Petri WA, Haque R, 2005. Real-time-PCR assay for diagnosis of Entamoeba histolytica infection. J Clin Microbiol 43: 2168–2172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23.Verweij JJ, Blangé RA, Templeton K, Schinkel J, Brienen EAT, van Rooyen MAA, van Lieshout L, Polderman AM, 2004. Simultaneous detection of Entamoeba histolytica, Giardia lamblia, and Cryptosporidium parvum in fecal samples by using multiplex real-time PCR. J Clin Microbiol 42: 1220–1223. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24.ten Hove R-J, van Lieshout L, Brienen EAT, Perez MA, Verweij JJ, 2008. Real-time polymerase chain reaction for detection of Isospora belli in stool samples. Diagn Microbiol Infect Dis 61: 280–283. [DOI] [PubMed] [Google Scholar]
  • 25.Verweij JJ, Brienen EAT, Ziem J, Yelifari L, Polderman AM, Van Lieshout L, 2007. Simultaneous detection and quantification of Ancylostoma duodenale, Necator americanus, and Oesophagostomum bifurcum in fecal samples using multiplex real-time PCR. Am J Trop Med Hyg 77: 685–690. [PubMed] [Google Scholar]
  • 26.Wiria AE, Prasetyani MA, Hamid F, Wammes LJ, Lell B, Ariawan I, Uh HW, Wibowo H, Djuardi Y, Wahyuni S, Sutanto I, May L, Luty AJ, Verweij JJ, Sartono E, Yazdanbakhsh M, Supali T, 2010. Does treatment of intestinal helminth infections influence malaria? Background and methodology of a longitudinal study of clinical, parasitological and immunological parameters in Nangapanda, Flores, Indonesia (ImmunoSPIN Study). BMC Infect Dis 10: 77. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27.Wichmann D, Panning M, Quack T, Kramme S, Burchard G-D, Grevelding C, Drosten C, 2009. Diagnosing schistosomiasis by detection of cell-free parasite DNA in human plasma. PLoS Negl Trop Dis 3: e422. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28.Verweij JJ, Canales M, Polman K, Ziem J, Brienen EAT, Polderman AM, van Lieshout L, 2009. Molecular diagnosis of Strongyloides stercoralis in faecal samples using real-time PCR. Trans R Soc Trop Med Hyg 103: 342–346. [DOI] [PubMed] [Google Scholar]
  • 29.Praet N, Verweij JJ, Mwape KE, Phiri IK, Muma JB, Zulu G, van Lieshout L, Rodriguez-Hidalgo R, Benitez-Ortiz W, Dorny P, Gabriël S, 2013. Bayesian modelling to estimate the test characteristics of coprology, coproantigen ELISA and a novel real-time PCR for the diagnosis of taeniasis. Trop Med Int Health 18: 608–614. [DOI] [PubMed] [Google Scholar]
  • 30.Liu J, Gratz J, Amour C, Kibiki G, Becker S, Janaki L, Verweij JJ, Taniuchi M, Sobuz SU, Haque R, Haverstick DM, Houpt ER, 2013. A laboratory-developed TaqMan Array Card for simultaneous detection of 19 enteropathogens. J Clin Microbiol 51: 472–480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Llewellyn S, Inpankaew T, Nery SV, Gray DJ, Verweij JJ, Clements ACA, Gomes SJ, Traub R, McCarthy JS, 2016. Application of a multiplex quantitative PCR to assess prevalence and intensity of intestinal parasite infections in a controlled clinical trial. PLoS Negl Trop Dis 10: e0004380. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Stark D, Al-Qassab SE, Barratt JLN, Stanley K, Roberts T, Marriott D, Harkness J, Ellis JT, 2011. Evaluation of multiplex tandem real-time PCR for detection of Cryptosporidium spp., Dientamoeba fragilis, Entamoeba histolytica, and Giardia intestinalis in clinical stool samples. J Clin Microbiol 49: 257–262. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Jex AR, Stanley KK, Lo W, Littman R, Verweij JJ, Campbell BE, Nolan MJ, Pangasa A, Stevens MA, Haydon S, Gasser RB, 2012. Detection of diarrhoeal pathogens in human faeces using an automated, robotic platform. Mol Cell Probes 26: 11–15. [DOI] [PubMed] [Google Scholar]
  • 34.Wessels E, Rusman LG, van Bussel MJAWM, Claas ECJ, 2014. Added value of multiplex Luminex Gastrointestinal Pathogen Panel (xTAG® GPP) testing in the diagnosis of infectious gastroenteritis. Clin Microbiol Infect 20: O182–O187. [DOI] [PubMed] [Google Scholar]
  • 35.McAuliffe GN, Anderson TP, Stevens M, Adams J, Coleman R, Mahagamasekera P, Young S, Henderson T, Hofmann M, Jennings LC, Murdoch DR, 2013. Systematic application of multiplex PCR enhances the detection of bacteria, parasites, and viruses in stool samples. J Infect 67: 122–129. [DOI] [PubMed] [Google Scholar]
  • 36.Mengelle C, Mansuy JM, Prere MF, Grouteau E, Claudet I, Kamar N, Huynh A, Plat G, Benard M, Marty N, Valentin A, Berry A, Izopet J, 2013. Simultaneous detection of gastrointestinal pathogens with a multiplex Luminex-based molecular assay in stool samples from diarrhoeic patients. Clin Microbiol Infect 19: E458–E465. [DOI] [PubMed] [Google Scholar]
  • 37.Claas EC, Burnham C-AD, Mazzulli T, Templeton K, Topin F, 2013. Performance of the xTAG® gastrointestinal pathogen panel, a multiplex molecular assay for simultaneous detection of bacterial, viral, and parasitic causes of infectious gastroenteritis. J Microbiol Biotechnol 23: 1041–1045. [DOI] [PubMed] [Google Scholar]
  • 38.Svraka-Latifovic S, Bouter S, Naus H, Bakker LJ, Timmerman CP, Dorigo-Zetsma JW, 2014. Impact of transition from microscopy to molecular screening for detection of intestinal protozoa in Dutch patients. Clin Microbiol Infect 20: O969–O971. [DOI] [PubMed] [Google Scholar]
  • 39.Easton AV, Oliveira RG, O’Connell EM, Kepha S, Mwandawiro CS, Njenga SM, Kihara JH, Mwatele C, Odiere MR, Brooker SJ, Webster JP, Anderson RM, Nutman TB, 2016. Multi-parallel qPCR provides increased sensitivity and diagnostic breadth for gastrointestinal parasites of humans: field-based inferences on the impact of mass deworming. Parasit Vectors 9: 38. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Pilotte N, Papaiakovou M, Grant JR, Bierwert LA, Llewellyn S, McCarthy JS, Williams SA, 2016. Improved PCR-based detection of soil transmitted helminth infections using a next-generation sequencing approach to assay design. PLoS Negl Trop Dis 10: e0004578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 41.Hotez P, 2011. Enlarging the “Audacious Goal”: elimination of the world’s high prevalence neglected tropical diseases. Vaccine 29: D104–D110. [DOI] [PubMed] [Google Scholar]
  • 42.El Safadi D, Gaayeb L, Meloni D, Cian A, Poirier P, Wawrzyniak I, Delbac F, Dabboussi F, Delhaes L, Seck M, Hamze M, Riveau G, Viscogliosi E, 2014. Children of Senegal River Basin show the highest prevalence of Blastocystis sp. ever observed worldwide. BMC Infect Dis 14: 164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 43.Tine RCK, Faye B, Ndour CT, Sylla K, Sow D, Ndiaye M, Ndiaye JL, Magnussen P, Alifrangis M, Bygbjerg IC, Gaye O, 2013. Parasitic infections among children under five years in Senegal: prevalence and effect on anaemia and nutritional status. ISRN Parasitol 2013: 272701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Girginkardeşler N, Coşkun S, Cüneyt Balcioğlu I, Ertan P, Ok UZ, 2003. Dientamoeba fragilis, a neglected cause of diarrhea, successfully treated with secnidazole. Clin Microbiol Infect Off Publ Eur Soc Clin Microbiol Infect Dis 9: 110–113. [DOI] [PubMed] [Google Scholar]
  • 45.Requena-Méndez A, Chiodini P, Bisoffi Z, Buonfrate D, Gotuzzo E, Muñoz J, 2013. The laboratory diagnosis and follow up of strongyloidiasis: a systematic review. PLoS Negl Trop Dis 7: e2002. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The American Journal of Tropical Medicine and Hygiene are provided here courtesy of The American Society of Tropical Medicine and Hygiene

RESOURCES