Table 1.
Primer and probe sequences included in the O’nyong-nyong virus (ONNV) real-time reverse transcription polymerase chain reaction
| Name | Sequence (5′ → 3′) | Concentration* (nM) | Location† |
|---|---|---|---|
| ONNV forward | CGCAGCTTACGGGTTTCATA | 200 | 21–40 |
| ONNV reverse | GCAACGCCTTCAGAAACGC | 200 | 116–134 |
| ONNV probe‡ | TGCTCTACTCTGCATTGCAAGA | 400 | 42–63 |
*
The concentration of each oligonucleotide in the final reaction mixture is provided.
†
Genomic locations are provided based on the reference sequence ONNV Gulu strain (Genbank: M20303.1).
‡
The 5′ fluorophore and 3′ quencher on the ONNV probe were FAM and BHQ-1, respectively.