Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| a. Primer and probe sequences | ||||
|---|---|---|---|---|
|
| ||||
| Oligo name | Sequence 5′-3′ | Final concentration | ||
| AReoV_For_111027 | AGCGTGCAAGCCGCAAT | 0.25 μM | ||
| AReoV_Pr_111027 | GGAGGTACGTGTGCCAAACTTT | 0.50 μM | ||
| AReoV_Rev_111027 | TGTWATDCCTTCAACRAAMGAGTG | 0.25 μM | ||
|
| ||||
| b. Real-time PCR cycling parameters | ||||
|
| ||||
| Step | Temperature (°C) |
Hold (min:s) |
Ramp (°C/s) |
Cycles (X) |
|
| ||||
| Reverse transcription | 45 | 10:00 | 4.4 | 1 |
| Activation | 95 | 10:00 | 4.4 | 1 |
| Denaturation | 94 | 00:05 | 2.2 | 45 |
| Annealing/extension | 60 | 01:00 | 2.2 | |
| Cooling | 40 | 10:00 | 2.2 | 1 |
