Table 3. Primers and probes used in this study.

Purpose	Primer and probe	Target gene and positiona	Sequence (5′–3′)	Reference
Quantitative PCR (DNA recovery)	pgL1908f	luc gene, 1,908–1,927	AGGAAGCTTTCCATGGAAGA	Nishimura et al.28
	Luc175r	luc gene, 2,082–2,063	CAGCGTAAGTGATGTCCACC	Nishimura et al.28
	n-LucHP1b	luc gene, 2,008–2,029	TGAAGAGATACGCCCTGGTTCC	Nishimura et al.28
	n-LucHP2c	luc gene, 2,030–2,058	GGAACAATTGCTTTTACAGATGCACATA	Nishimura et al.28
Quantitative PCR (bacterial abundance)	EUB f933	16S rRNA, 933–954	GCACAAGCGGTGGAGCATGTGG	Iwamoto et al.35
	EUB r1387	16S rRNA, 1,387–1,368	GCCCGGGAACGTATTCACCG	Iwamoto et al.35
Pyrosequencing	968fd	16S rRNA, 968–984	AACGCGAAGAACCTTAC	Felske et al.36
	1401re	16S rRNA, 1,401–1,385	CGGTGTGTACAAGACCC	Felske et al.36

Abbreviations: FITC, fluorescein isothiocyanate; rRNA, ribosomal RNA.

^aluc gene: numbering as for bases of pGeneGRIP-Luc (Genlantis, San Diego, CA, USA); 16S rRNA gene: Escherichia coli numbering system.

^b3′ Terminus was labeled with FITC.

^c5′ Terminus was labeled with LCRed640.

^d454 FLX-titanium adapter “A” sequence (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAG-3′) and barcode sequence were added at the 5′ terminus for the second PCR.

^e454 FLX-titanium adapter “B” sequence (5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG-3′) was added at the 5′ terminus for the second PCR.