Table 1.
Known and candidate SNP markers of sporadic AD near TBP-binding sites in the promoter of the human genes associated with susceptibility to cancers.
| Gene (OMIM ID) | dbSNP rel. 147 or see (Ref) | 5′ flank |
wt mut |
3′ flank | K D , nM | Known diseases (known SNP markers) or hypothetical disease (candidate SNP markers) | (Ref) or (this work) | ||||
|---|---|---|---|---|---|---|---|---|---|---|---|
|
wt mut |
Δ | Z | α | ρ | |||||||
| GSTM3 (138390) | rs1332018 | ccccttatgt |
c a |
gggtataaag |
4 3 |
= | 2 | E | “c” associated with AD and renal cell carcinomas (Wb: TF-binding site damaged, not TBP-binding site) | Hong et al., 2009; Tan et al., 2013 | |
| rs200209906 | gtataaagcc |
c t,a |
ctcccgctca |
3.6 4.3 |
↓ | 2 | E | (hypothetically) higher risks of AD and renal cell carcinoma | (this work) | ||
| rs750789679 | cgggtataaa |
g c |
cccctcccgc |
3.6 4.5 |
↓ | 3 | 10−2 | C | |||
| rs748231432 | cccttatgtc |
g c,t |
ggtataaagc |
3.6 3.0 |
↑ | 3 | 0.05 | D | (hypothetically) lower risks of AD and renal cell carcinomas | ||
| rs763859166 | gggtataaag |
c t |
ccctcccgct |
3.6 2.9 |
↑ | 3 | 10−2 | C | |||
| IL1B (147720) | rs1143627 | ttttgaaagc |
c t |
ataaaaacag |
5 2 |
↑ | 15 | 10−6 | A | Liver cancer; gastric cancer, gastric ulcer, and chronic gastritis in Hp-infection; non-small cell lung cancer, Graves' disease, recurrent major depression, greater body fat; (hypothetically) greater Aβ-plaque clearance and blood-brain barrier damage in AD | Ponomarenko et al., 2015, (this work) Rivera-Escalera et al., 2014; Wang et al., 2014 |
| rs549858786 | tgaaagccat |
a t |
aaaacagcga |
5 7 |
↓ | 8 | 10−6 | A | (hypothetically) lower Aβ-plaque clearance and smaller blood-brain barrier damage in AD | ||
| DHFR (126060) | rs10168 | ctgcacaaat |
g a |
gggacgaggg | 15 9 | ↑ | 9 | 10−6 | A | Resistance to methotrexate treatment of leukemia and, also, (hypothetically) lower risk of AD | Al-Shakfa et al., 2009 |
| rs750793297 | tgcacaaatg |
g t |
ggacgagggg |
15 13 |
↑ | 3 | 10−2 | C | (hypothetically) lower risk of AD and resistance to methotrexate treatment of leukemi | (this work) Banka et al., 2011; Turnaev et al., 2016 | |
| rs766799008 | ctgcacaaat |
a g |
tggggacgag |
15 19 |
↓ | 3 | 10−3 | B | (hypothetically) higher risk of AD and greater effectiveness of methotrexate-based therapy for leukemia in children | ||
| rs764508464 | ctgcacaaat |
a – |
tggggacgag |
15 37 |
↓ | 17 | 10−6 | A | |||
| rs754122321 | ctcgcctgca |
c g |
aaatggggac |
15 25 |
↓ | 9 | 10−3 | B | |||
Hereinafter, ancestral (wt) and minor (mut) alleles; KD, dissociation constant of TBP–DNA (Savinkova et al., 2013); Δ, a change: excess (↑), deficit (↓), norm (=); α = 1–p, significance {where p value is shown in Figure 1}; ρ, heuristic ranks of candidate SNP markers varying in alphabetical order from the “best” (A) to the “worst” (E); 18 bp, the 18-bp deletion g−72ggcggacatacatatac−54 (the human CETP gene); 25 bp, the 25-bp deletion g−63cggcccgtttctcgggcttcgggc−39 (the human PSEN1 gene); Aβ, β-amyloid; AD, Alzheimer's disease; ALS, amyotrophic lateral sclerosis; AS, atherosclerosis; DM, diabetes mellitus; EMSA, electrophoretic mobility shift assay; Hb, hemoglobins; Hp, Helicobacter pilori; LUC, luciferase reporter assay; TF, transcription factor; T1D, type 1 diabetes; Wb: western blot.