Table 2.
Name | Fluorochrome | Sequence (5’➔ 3′) | Quencher | Nt | Tm (°C) | Degeneracy |
---|---|---|---|---|---|---|
F1 | GGTGCGATGATGAAGTCTGG | 20 | 60.5 | 0 | ||
R1 | CTATGATATTGACTTCCATGTTCA | 24 | 58.3 | 0 | ||
F2A | ATGATGAARTCIGGIATGTTYYT | 23 | 53.9–59.2 | 8 | ||
F2B | ATGATGAARTCNGGNATGTT | 20 | 50.2–56.4 | 32 | ||
R2A | ATYTTIACTTCCATGTTCATCCA | 23 | 55.5–57.6 | 2 | ||
R3A | ATYTTIACTTCCATRTTCARCCA | 23 | 53.9–59.2 | 8 | ||
R4A | ATYTTIACTTCCATGTTGACCCA | 23 | 57.6–59.2 | 2 | ||
R2B | ATYTTNACTTCCATGTTCATCCA | 23 | 55.5–59.2 | 8 | ||
R3B | ATYTTNACTTCCATRTTCARCCA | 23 | 53.9–60.9 | 32 | ||
R4B | ATYTTNACTTCCATGTTGACCCA | 23 | 57.6–60.9 | 8 | ||
P1 | ATTO425 | AT + GTT + GTC + GT + CN + CC | BHQ1/LNA™ | 14 | 40.8–43.7/66–69 | 4 |
P2 | ATTO425 | AT + GTT + GTC + GT + CIC + CIAT | BHQ1/LNA™ | 17 | 47.5/67 | 0 |
Variable melting temperature was indicated for degenerate primers. Degenerate nucleotides were shown in bold. Y accounted for C/T, R for A/G, N for A or T or C or G. I was used as an alternative for N. ATTO425 labeled probes were quenched using Black Hole Quencher 1 (BHQ1). Locked Nucleic Acid nucleotides (LNA™) were prefixed with a “+” sign and the resulted increase in Tm was indicated following use of Exiqon™ tool for calculation