Skip to main content
PMC home page
Scientific Data logoLink to Scientific Data
. 2017 Jul 25;4:170092. doi: 10.1038/sdata.2017.92

A metagenomic survey of forest soil microbial communities more than a decade after timber harvesting

Roland C Wilhelm 1,*, Erick Cardenas 1,*, Hilary Leung 1, Kendra Maas 1, Martin Hartmann 2, Aria Hahn 1, Steven Hallam 1, William W Mohn 1,a,†
PMCID: PMC5525643  PMID: 28765786

Abstract

The scarcity of long-term data on soil microbial communities in the decades following timber harvesting limits current understanding of the ecological problems associated with maintaining the productivity of managed forests. The high complexity of soil communities and the heterogeneity of forest and soil necessitates a comprehensive approach to understand the role of microbial processes in managed forest ecosystems. Here, we describe a curated collection of well replicated, multi-faceted data from eighteen reforested sites in six different North American ecozones within the Long-term Soil Productivity (LTSP) Study, without detailed analysis of results or discussion. The experiments were designed to contrast microbial community composition and function among forest soils from harvested treatment plots with varying intensities of organic matter removal. The collection includes 724 bacterial (16S) and 658 fungal (ITS2) amplicon libraries, 133 shotgun metagenomic libraries as well as stable isotope probing amplicon libraries capturing the effects of harvesting on hemicellulolytic and cellulolytic populations. This collection serves as a foundation for the LTSP Study and other studies of the ecology of forest soil and forest disturbance.

Subject terms: Soil microbiology, Molecular ecology, Forest ecology, Metagenomics

Background & Summary

The Long-term Soil Productivity Study (LTSP) was initiated in 1989 to track changes in soil quality and productivity of managed forests. Foresters lacked data on the impact of growing trends in intensified forest management, such as shorter crop cycles, greater biomass extraction, and use of highly mechanized equipment1. Partners in the LTSP Study have since collected longitudinal data from a range of North America’s most-productive forests (>100 sites) to assess the long-term effects of soil compaction and organic matter (OM) removal. The objective is to develop indices for monitoring soil quality based in physical, chemical, and biological properties of soil. Each LTSP site has replicated experimental plots for harvested treatments with three intensities of OM removal as well as unharvested reference plots. OM removal intensity corresponded to common harvesting strategies, such as debranching in situ (OM1) or removal of both trunks and branches (OM2), or the less common, and extreme, practice of removing trunks, branches and top soil (OM3). In the ensuing years, these treatments produced a consistent gradient in soil properties according to harvesting intensity, such as decreasing amounts of total carbon and nitrogen as well as increased dryness, mean daily temperature and temperature fluctuation. While the latest LTSP studies show that the effects of varying degrees of OM removal appear minor on net primary productivity2,3,4, the metagenomic datasets presented here show consistent changes in bacterial and fungal populations that reflected harvesting intensity5,6,7,8,9.

We collected data on soil microbial communities from all treatment plots at eighteen LTSP sites in six different ecozones between 2008 and 2014 when reforested stands were 11 to 17 years old (Fig. 1; Table 1). To capture the extent of harvesting impacts throughout the soil profile, corresponding samples from organic and mineral layers were included in all datasets. The goal was to identify changes in community composition, diversity, and functional potential resulting from the intensity of OM removal. We surveyed soil microbial communities in treatment plots using amplicon sequencing (Table 2 (available online only)) of bacteria (Data Citation 1) and fungi (Data Citation 2), along with shotgun metagenomes from all treatment plots at a single site within each ecozone (Data Citation 3; Table 3 (available online only)). Shotgun metagenomes revealed impacts on the functional potential of communities, such as decomposers involved in carbon cycling5, which led to further targeted studies of hemicellulolytic7 (Data Citations 4,5) and cellulolytic8 populations (Data Citation 6) using 13C-stable isotope probing (Table 4 (available online only)). Stable isotope probing (SIP) can be used to track populations that assimilate 13C-label into their biomass by recovering and sequencing the resultant ‘heavier’13C-enriched DNA10.

Figure 1. Locations of soil sampling and descriptions of data collection conducted for this study.

Figure 1

Open in a new tab

The locations and names of eighteen North American sampling sites are shown grouped into six ecozones. The term ‘ecozone’ is used to refer to the distinct local assemblages of organisms and climatic factors between groupings of sites. An overview of the design for soil sampling along with data collection are superimposed on the map. OM removal treatments are shaded according to the intensity of OM removal.

Table 1. Site information for all sampling locations utilized in this study.

Site Name Ecozone code Site code Region Latitude Longitude Elevation (m) Soil classification Tree cover Climatic zone Annual mean temp (°C) Precipitation—warmest quarter (mm) Year established Sample collection date Country
Fensom BSON A7 Ontario 49.07 −89.41 445 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 2.4 266 1995 7/3/2011 Canada
Fensom BSON A8 Ontario 49.08 −89.38 450 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 1.8 266 1995 7/4/2011 Canada
Fensom BSON A9 Ontario 49.07 −89.39 442 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 1.5 266 1995 7/5/2011 Canada
Brandy City PPCA BR California 39.55 −121.04 1135 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer 11.2 55 1995 6/22/2011 USA
Blodgett PPCA BL California 38.88 −120.64 1350 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer 11.2 55 1995 9/16/2011 USA
Lowell Hill PPCA LH California 39.26 −120.78 1268 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer 11.2 55 1995 9/16/2011 USA
Wells JPON JW Ontario 46.42 −83.37 228 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer 4.4 248 1993–1994 7/7/2011 Canada
Superior JPON JS Ontario 47.57 −82.85 426 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer 1.7 250 1993–1994 8/4/2011 Canada
Eddy JPON JE Ontario 46.75 −82.25 490 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer 2.8 242 1993–1994 8/3/2011 Canada
Kurth LPTX TXA Texas 31.11 −95.15 88 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical 19.0 253 1997 3/12/2012 USA
Kurth LPTX TXB Texas 31.11 −95.15 88 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical 19.0 253 1997 3/12/2012 USA
Kurth LPTX TXC Texas 31.11 −95.15 88 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical 19.0 253 1997 3/12/2012 USA
O’Connor Lake IDFBC OC British Columbia 50.88 −120.35 1075 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer 2.5 300 1999 6/26/2010 Canada
Black Pines IDFBC BP British Columbia 50.93 −120.28 1180 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer 2.5 300 1999 6/22/2010 Canada
Dairy Creek IDFBC DC British Columbia 50.85 −120.42 1150 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer 2.5 300 1999 6/25/2010 Canada
Log Lake SBSBC LL British Columbia 54.35 −122.61 780 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer 3.3 146–193 1994 7/9/2008 Canada
Topley SBSBC TO British Columbia 52.32 −126.31 1100 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer 1.7 146–193 1994 7/11/2008 Canada
Skulow Lake SBSBC SL British Columbia 52.32 −121.92 1050 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer 3.8 146–193 1995 8/14/2009 Canada
Open in a new tab

Table 2. Sequencing and sample data for all field whole genome shotgun libraries.

Sample Alias Sample ID Ecozone Region Site Environmental Source DNA Source Library Preparation Library Type Common Name Instrument Model Data Repository ENA Study Accession Sample Accession Secondary Sample Accession Experiment Accession Run Accession Phylogenetic Marker Target Gene Subfragment Barcode Forward Primer Reverse Primer Collection Date Latitude Longitude Country Sampling Depth Elevation Mean Annual Temperature (Celsius) Mean Annual Precipitation (mm) Soil Classification Tree Cover Climatic Zone LTSP Treatment Compaction Treatment Herbicide Use Horizon Moisture Content Total Carbon Total Nitrogen pH Soil Bulk Density CN Ratio
A7001F A7001 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039589 SAMEA3732440 ERX1297926 ERR1225714 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 48.0 42.5 1.1 5.4 0.2 37.9
A7002F A7002 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039590 SAMEA3732441 ERX1297927 ERR1225715 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 18.0 0.6 0.0 5.7 1.3 16.3
A7004F A7004 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039591 SAMEA3732442 ERX1297928 ERR1225716 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 16.0 1.2 0.1 6.0 1.0 20.1
A7007F A7007 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039592 SAMEA3732443 ERX1297929 ERR1225717 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 54.0 34.6 0.8 5.0 0.2 42.4
A7009F A7009 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039593 SAMEA3732444 ERX1297930 ERR1225718 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 30.0 34.9 0.9 4.4 0.2 39.8
A7011F A7011 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039594 SAMEA3732445 ERX1297931 ERR1225719 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 34.0 33.8 0.9 5.1 0.2 38.1
A7012F A7012 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039595 SAMEA3732446 ERX1297932 ERR1225720 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 19.0 1.4 0.1 5.7 1.0 21.5
A7015F A7015 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039596 SAMEA3732447 ERX1297933 ERR1225721 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 37.0 37.3 1.0 5.1 0.2 39.3
A7016F A7016 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039597 SAMEA3732448 ERX1297934 ERR1225722 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 25.0 2.5 0.1 5.5 1.1 21.3
A7019F A7019 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039598 SAMEA3732449 ERX1297935 ERR1225723 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 50.0 46.9 1.2 4.3 0.2 40.1
A7021F A7021 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039599 SAMEA3732450 ERX1297936 ERR1225724 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 45.0 40.5 1.2 4.5 0.2 33.7
A7022F A7022 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039600 SAMEA3732451 ERX1297937 ERR1225725 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 17.0 1.2 0.1 5.6 1.4 24.2
A7023F A7023 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039601 SAMEA3732452 ERX1297938 ERR1225726 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 64.0 44.9 1.1 4.5 0.2 42.1
A7024F A7024 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039602 SAMEA3732453 ERX1297939 ERR1225727 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.0 1.1 0.0 5.8 1.5 27.3
A7026F A7026 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039603 SAMEA3732454 ERX1297940 ERR1225728 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 26.0 1.4 0.1 5.3 1.1 21.4
A7027F A7027 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039604 SAMEA3732455 ERX1297941 ERR1225729 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 58.0 44.7 1.0 4.4 0.1 44.4
A7028F A7028 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039605 SAMEA3732456 ERX1297942 ERR1225730 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 25.0 2.1 0.1 5.3 0.9 24.3
A7029F A7029 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039606 SAMEA3732457 ERX1297943 ERR1225731 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.1 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 58.0 40.7 1.0 4.2 0.2 40.2
A7030F A7030 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039607 SAMEA3732458 ERX1297944 ERR1225732 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-03 49.07 -89.41 Canada 0.3 445 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 16.0 2.4 0.1 5.2 0.9 20.3
A8031F A8031 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039608 SAMEA3732459 ERX1297945 ERR1225733 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.1 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 54.0 41.4 1.2 4.6 0.2 35.4
A8036F A8036 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039609 SAMEA3732460 ERX1297946 ERR1225734 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 14.0 0.8 0.0 5.6 1.7 21.6
A8037F A8037 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039610 SAMEA3732461 ERX1297947 ERR1225735 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.1 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 46.0 42.3 1.1 5.0 0.2 39.1
A8038F A8038 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039611 SAMEA3732462 ERX1297948 ERR1225736 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 19.0 1.3 0.1 5.0 1.3 20.8
A8040F A8040 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039612 SAMEA3732463 ERX1297949 ERR1225737 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 25.5 1.6 0.1 5.4 1.3 21.6
A8041F A8041 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039613 SAMEA3732464 ERX1297950 ERR1225738 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.1 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 43.2 42.0 1.2 5.0 0.1 35.4
A8042F A8042 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039614 SAMEA3732465 ERX1297951 ERR1225739 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 18.0 2.1 0.1 5.2 1.6 20.9
A8045F A8045 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039615 SAMEA3732466 ERX1297952 ERR1225740 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.1 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 36.0 41.6 1.2 4.7 0.2 34.2
A8046F A8046 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039616 SAMEA3732467 ERX1297953 ERR1225741 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 24.0 2.1 0.1 5.3 1.1 21.7
A8047F A8047 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039617 SAMEA3732468 ERX1297954 ERR1225742 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.1 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 53.0 41.7 1.2 4.5 0.3 35.5
A8048F A8048 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039618 SAMEA3732469 ERX1297955 ERR1225743 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 21.0 0.9 0.0 5.4 1.7 23.6
A8050F A8050 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039619 SAMEA3732470 ERX1297956 ERR1225744 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 21.0 1.3 0.1 5.7 1.7 20.3
A8053F A8053 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039620 SAMEA3732471 ERX1297957 ERR1225745 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.1 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 52.0 37.3 0.8 4.5 0.2 47.4
A8054F A8054 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039621 SAMEA3732472 ERX1297958 ERR1225746 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 23.0 1.7 0.1 5.4 1.3 23.7
A8056F A8056 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039622 SAMEA3732473 ERX1297959 ERR1225747 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 26.0 2.5 0.1 5.2 1.0 23.1
A8058F A8058 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039623 SAMEA3732474 ERX1297960 ERR1225748 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 28.0 3.3 0.1 4.9 0.8 27.3
A8059F A8059 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039624 SAMEA3732475 ERX1297961 ERR1225749 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.1 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 73.0 45.7 1.1 4.2 0.1 43.5
A8060F A8060 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039625 SAMEA3732476 ERX1297962 ERR1225750 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-04 49.08 -89.38 Canada 0.3 450 0.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 29.0 1.7 0.1 5.2 1.0 18.4
A9062F A9062 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039626 SAMEA3732477 ERX1297963 ERR1225751 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 20.0 3.3 0.1 5.4 0.9 23.5
A9063F A9063 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039627 SAMEA3732478 ERX1297964 ERR1225752 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 59.0 35.3 1.1 5.4 0.2 31.9
A9064F A9064 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039628 SAMEA3732479 ERX1297965 ERR1225753 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 24.0 2.2 0.1 5.6 1.2 21.2
A9067F A9067 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039629 SAMEA3732480 ERX1297966 ERR1225754 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 53.0 32.6 0.9 5.4 0.2 37.2
A9068F A9068 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039630 SAMEA3732481 ERX1297967 ERR1225755 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 23.0 2.3 0.1 5.8 1.2 18.3
A9070F A9070 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039631 SAMEA3732482 ERX1297968 ERR1225756 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 20.0 0.7 0.0 5.8 1.2 17.5
A9073F A9073 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039632 SAMEA3732483 ERX1297969 ERR1225757 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 64.0 45.1 1.1 5.0 0.2 40.2
A9074F A9074 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039633 SAMEA3732484 ERX1297970 ERR1225758 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 32.0 2.8 0.1 5.3 1.2 24.4
A9076F A9076 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039634 SAMEA3732485 ERX1297971 ERR1225759 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 21.0 1.5 0.1 5.6 1.2 19.3
A9077F A9077 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039635 SAMEA3732486 ERX1297972 ERR1225760 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 42.0 27.7 0.7 5.8 0.2 40.1
A9078F A9078 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039636 SAMEA3732487 ERX1297973 ERR1225761 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 15.0 0.7 0.0 6.0 1.3 18.6
A9081F A9081 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039637 SAMEA3732488 ERX1297974 ERR1225762 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 76.0 13.4 0.3 5.3 0.2 46.2
A9082F A9082 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039638 SAMEA3732489 ERX1297975 ERR1225763 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 19.0 1.6 0.1 6.1 1.1 19.9
A9083F A9083 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039639 SAMEA3732490 ERX1297976 ERR1225764 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 69.0 29.0 0.9 5.4 0.2 30.9
A9085F A9085 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039640 SAMEA3732491 ERX1297977 ERR1225765 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 64.0 43.9 1.2 4.8 0.1 35.7
A9086F A9086 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039641 SAMEA3732492 ERX1297978 ERR1225766 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 28.0 1.9 0.1 5.4 1.2 18.9
A9087F A9087 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039642 SAMEA3732493 ERX1297979 ERR1225767 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 57.0 45.5 1.1 4.8 0.1 39.9
A9088F A9088 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039643 SAMEA3732494 ERX1297980 ERR1225768 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 30.0 1.4 0.1 5.9 1.4 20.1
A9089F A9089 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039644 SAMEA3732495 ERX1297981 ERR1225769 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 71.0 44.2 1.0 4.7 0.1 43.1
A9090F A9090 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039645 SAMEA3732496 ERX1297982 ERR1225770 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 25.0 1.2 0.1 5.6 1.5 22.3
A9092F A9092 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039646 SAMEA3732497 ERX1297983 ERR1225771 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 19.0 NA NA 0.0 NA NA
A9093F A9093 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039647 SAMEA3732498 ERX1297984 ERR1225772 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 O horizon 54.0 NA NA 0.0 NA NA
A9094F A9094 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039648 SAMEA3732499 ERX1297985 ERR1225773 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 17.0 NA NA 0.0 NA NA
A9096F A9096 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039649 SAMEA3732500 ERX1297986 ERR1225774 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 9.0 NA NA 0.0 NA NA
A9097F A9097 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039650 SAMEA3732501 ERX1297987 ERR1225775 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 O horizon 39.0 NA NA 0.0 NA NA
A9099F A9099 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039651 SAMEA3732502 ERX1297988 ERR1225776 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 O horizon 48.0 NA NA 0.0 NA NA
A9100F A9100 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039652 SAMEA3732503 ERX1297989 ERR1225777 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 13.0 NA NA 0.0 NA NA
A9101F A9101 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039653 SAMEA3732504 ERX1297990 ERR1225778 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 O horizon 29.0 NA NA 0.0 NA NA
A9102F A9102 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039654 SAMEA3732505 ERX1297991 ERR1225779 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 7.6 NA NA 0.0 NA NA
A9103F A9103 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039655 SAMEA3732506 ERX1297992 ERR1225780 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 O horizon 14.0 NA NA 0.0 NA NA
A9104F A9104 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039656 SAMEA3732507 ERX1297993 ERR1225781 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 13.0 NA NA 0.0 NA NA
A9105F A9105 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039657 SAMEA3732508 ERX1297994 ERR1225782 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 O horizon 48.0 NA NA 0.0 NA NA
A9106F A9106 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039658 SAMEA3732509 ERX1297995 ERR1225783 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 19.0 NA NA 0.0 NA NA
A9107F A9107 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039659 SAMEA3732510 ERX1297996 ERR1225784 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.1 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 O horizon 38.0 NA NA 0.0 NA NA
A9108F A9108 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039660 SAMEA3732511 ERX1297997 ERR1225785 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-05 49.07 -89.39 Canada 0.3 442 0.4 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer 99 C0 0 A horizon 21.0 NA NA 0.0 NA NA
BL025F BL025 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039661 SAMEA3732512 ERX1297998 ERR1225786 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 18.0 NA NA 4.8 NA NA
BL026F BL026 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039662 SAMEA3732513 ERX1297999 ERR1225787 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 22.0 5.5 0.3 5.7 NA 19.8
BL027F BL027 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039663 SAMEA3732514 ERX1298000 ERR1225788 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 17.0 NA NA 4.9 NA NA
BL028F BL028 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039664 SAMEA3732515 ERX1298001 ERR1225789 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 21.0 5.5 0.3 5.9 NA 19.8
BL029F BL029 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039665 SAMEA3732516 ERX1298002 ERR1225790 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 19.0 NA NA 4.7 NA NA
BL030F BL030 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039666 SAMEA3732517 ERX1298003 ERR1225791 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 24.0 5.5 0.3 5.9 NA 19.8
BL031F BL031 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039667 SAMEA3732518 ERX1298004 ERR1225792 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 29.0 NA NA 5.7 NA NA
BL032F BL032 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039668 SAMEA3732519 ERX1298005 ERR1225793 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 21.0 5.4 0.3 5.8 NA 20.6
BL033F BL033 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039669 SAMEA3732520 ERX1298006 ERR1225794 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 22.0 NA NA 5.2 NA NA
BL034F BL034 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039670 SAMEA3732521 ERX1298007 ERR1225795 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 21.0 5.4 0.3 5.3 NA 20.6
BL035F BL035 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039671 SAMEA3732522 ERX1298008 ERR1225796 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 16.0 NA NA 5.1 NA NA
BL038F BL038 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039672 SAMEA3732523 ERX1298009 ERR1225797 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 22.0 5.3 0.3 5.4 NA 18.9
BL039F BL039 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039673 SAMEA3732524 ERX1298010 ERR1225798 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 24.0 NA NA 5.3 NA NA
BL041F BL041 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039674 SAMEA3732525 ERX1298011 ERR1225799 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 23.0 NA NA 5.1 NA NA
BL043F BL043 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039675 SAMEA3732526 ERX1298012 ERR1225800 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 27.0 NA NA 4.5 NA NA
BL044F BL044 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039676 SAMEA3732527 ERX1298013 ERR1225801 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 18.0 6.3 0.3 5.5 NA 20.3
BL046F BL046 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039677 SAMEA3732528 ERX1298014 ERR1225802 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 18.0 6.3 0.3 5.5 NA 20.3
BL047F BL047 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039678 SAMEA3732529 ERX1298015 ERR1225803 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 30.0 NA NA 4.9 NA NA
BL048F BL048 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039679 SAMEA3732530 ERX1298016 ERR1225804 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 15.0 6.3 0.3 6.0 NA 20.3
BR049F BR049 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039680 SAMEA3732531 ERX1298017 ERR1225805 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 54.0 NA NA 5.4 NA NA
BR050F BR050 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039681 SAMEA3732532 ERX1298018 ERR1225806 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 35.0 6.4 0.3 5.9 NA 25.8
BR051F BR051 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039682 SAMEA3732533 ERX1298019 ERR1225807 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 55.0 NA NA 4.3 NA NA
BR052F BR052 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039683 SAMEA3732534 ERX1298020 ERR1225808 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 34.0 6.4 0.3 5.2 NA 25.8
BR053F BR053 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039684 SAMEA3732535 ERX1298021 ERR1225809 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 58.0 NA NA 4.4 NA NA
BR054F BR054 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039685 SAMEA3732536 ERX1298022 ERR1225810 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 32.0 6.4 0.3 5.3 NA 25.8
BR055F BR055 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039686 SAMEA3732537 ERX1298023 ERR1225811 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 50.0 NA NA 5.7 NA NA
BR056F BR056 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039687 SAMEA3732538 ERX1298024 ERR1225812 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 36.0 5.7 0.3 6.1 NA 20.9
BR057F BR057 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039688 SAMEA3732539 ERX1298025 ERR1225813 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 51.0 NA NA 5.0 NA NA
BR058F BR058 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039689 SAMEA3732540 ERX1298026 ERR1225814 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 35.0 5.7 0.3 6.3 NA 20.9
BR059F BR059 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039690 SAMEA3732541 ERX1298027 ERR1225815 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 45.0 NA NA 5.9 NA NA
BR060F BR060 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039691 SAMEA3732542 ERX1298028 ERR1225816 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 37.0 5.7 0.3 6.1 NA 20.9
BR062F BR062 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039692 SAMEA3732543 ERX1298029 ERR1225817 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 34.0 5.2 0.3 5.5 NA 19.2
BR063F BR063 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039693 SAMEA3732544 ERX1298030 ERR1225818 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 50.0 NA NA 4.8 NA NA
BR064F BR064 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039694 SAMEA3732545 ERX1298031 ERR1225819 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 33.0 5.2 0.3 5.4 NA 19.2
BR065F BR065 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039695 SAMEA3732546 ERX1298032 ERR1225820 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 51.0 NA NA 5.6 NA NA
BR066F BR066 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039696 SAMEA3732547 ERX1298033 ERR1225821 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 35.0 5.2 0.3 5.8 NA 19.2
BR067F BR067 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039697 SAMEA3732548 ERX1298034 ERR1225822 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 61.0 NA NA 5.0 NA NA
BR068F BR068 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039698 SAMEA3732549 ERX1298035 ERR1225823 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 28.0 5.8 0.3 6.0 NA 23.2
BR069F BR069 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039699 SAMEA3732550 ERX1298036 ERR1225824 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 48.0 NA NA 6.3 NA NA
BR070F BR070 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039700 SAMEA3732551 ERX1298037 ERR1225825 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 36.0 5.8 0.3 6.7 NA 23.2
BR072F BR072 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039701 SAMEA3732552 ERX1298038 ERR1225826 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 31.0 5.8 0.3 6.3 NA 23.2
JE085F JE085 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039702 SAMEA3732553 ERX1298039 ERR1225827 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 O horizon 34.0 41.5 1.3 3.7 5.7 34.6
JE088F JE088 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039703 SAMEA3732554 ERX1298040 ERR1225828 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 A horizon 10.0 2.6 0.2 5.0 5.7 15.9
JE090F JE090 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039704 SAMEA3732555 ERX1298041 ERR1225829 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 1 A horizon 8.0 3.0 0.2 5.0 5.7 16.4
JE092F JE092 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039705 SAMEA3732556 ERX1298042 ERR1225830 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 0 A horizon 8.0 3.0 0.2 5.0 5.7 16.4
JE093F JE093 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039706 SAMEA3732557 ERX1298043 ERR1225831 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 O horizon 20.0 40.5 1.3 3.7 5.7 32.3
JE095F JE095 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039707 SAMEA3732558 ERX1298044 ERR1225832 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 O horizon 32.0 40.5 1.3 3.7 5.7 32.3
JE096F JE096 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039708 SAMEA3732559 ERX1298045 ERR1225833 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 A horizon 13.0 2.9 0.2 5.0 5.7 15.9
JE098F JE098 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039709 SAMEA3732560 ERX1298046 ERR1225834 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 1 A horizon 11.0 1.9 0.1 5.2 5.7 13.6
JE100F JE100 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039710 SAMEA3732561 ERX1298047 ERR1225835 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 0 A horizon 11.0 1.9 0.1 5.2 5.7 13.6
JE101F JE101 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039711 SAMEA3732562 ERX1298048 ERR1225836 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 O horizon 31.0 38.5 1.2 3.6 5.7 32.7
JE102F JE102 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039712 SAMEA3732563 ERX1298049 ERR1225837 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 A horizon 7.0 2.1 0.2 5.1 5.7 13.5
JE103F JE103 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039713 SAMEA3732564 ERX1298050 ERR1225838 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 O horizon 24.0 38.5 1.2 3.6 5.7 32.7
JE104F JE104 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039714 SAMEA3732565 ERX1298051 ERR1225839 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 A horizon 13.0 2.1 0.2 5.1 5.7 13.5
JE105F JE105 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039715 SAMEA3732566 ERX1298052 ERR1225840 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 O horizon 27.0 41.4 1.3 3.8 5.7 33.8
JE106F JE106 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039716 SAMEA3732567 ERX1298053 ERR1225841 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 A horizon 7.0 2.4 0.2 5.1 5.7 13.9
JE107F JE107 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039717 SAMEA3732568 ERX1298054 ERR1225842 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 O horizon 24.0 41.4 1.3 3.8 5.7 33.8
JE108F JE108 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039718 SAMEA3732569 ERX1298055 ERR1225843 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 A horizon 12.0 2.4 0.2 5.1 5.7 13.9
JE110F JE110 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039719 SAMEA3732570 ERX1298056 ERR1225844 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 1 A horizon 14.0 1.9 0.1 5.2 5.7 13.9
JE113F JE113 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039720 SAMEA3732571 ERX1298057 ERR1225845 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 O horizon 50.0 41.6 1.4 3.7 5.7 31.6
JE114F JE114 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039721 SAMEA3732572 ERX1298058 ERR1225846 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 A horizon 11.0 2.6 0.2 5.0 5.7 16.1
JE115F JE115 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039722 SAMEA3732573 ERX1298059 ERR1225847 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 O horizon 56.0 41.6 1.4 3.7 5.7 31.6
JE117F JE117 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039723 SAMEA3732574 ERX1298060 ERR1225848 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 O horizon 42.0 39.6 1.3 3.8 5.7 33.5
JE118F JE118 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039724 SAMEA3732575 ERX1298061 ERR1225849 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 A horizon 21.0 2.5 0.2 4.9 5.7 15.3
JE119F JE119 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039725 SAMEA3732576 ERX1298062 ERR1225850 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 O horizon 48.0 39.6 1.3 3.8 5.7 33.5
JE120F JE120 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039726 SAMEA3732577 ERX1298063 ERR1225851 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 A horizon 10.0 2.5 0.2 4.9 5.7 15.3
JE121F JE121 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039727 SAMEA3732578 ERX1298064 ERR1225852 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 O horizon 69.0 43.2 1.4 3.6 5.7 30.8
JE122F JE122 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039728 SAMEA3732579 ERX1298065 ERR1225853 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 A horizon 15.0 2.4 0.2 4.9 5.7 16.4
JE123F JE123 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039729 SAMEA3732580 ERX1298066 ERR1225854 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 O horizon 47.0 38.1 1.2 3.7 5.7 30.8
JE124F JE124 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039730 SAMEA3732581 ERX1298067 ERR1225855 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 A horizon 15.0 2.8 0.2 4.9 5.7 17.8
JE125F JE125 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039731 SAMEA3732582 ERX1298068 ERR1225856 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 O horizon 74.0 38.9 1.3 3.6 5.7 29.8
JE126F JE126 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039732 SAMEA3732583 ERX1298069 ERR1225857 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 A horizon 22.0 1.7 0.1 4.8 5.7 16.4
JS043F JS043 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039733 SAMEA3732584 ERX1298070 ERR1225858 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 O horizon 43.0 44.5 1.1 4.0 7.9 39.6
JS044F JS044 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039734 SAMEA3732585 ERX1298071 ERR1225859 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 A horizon 8.0 0.8 0.0 5.2 7.9 27.1
JS045F JS045 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039735 SAMEA3732586 ERX1298072 ERR1225860 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 O horizon 34.0 44.5 1.1 4.0 7.9 39.6
JS050F JS050 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039736 SAMEA3732587 ERX1298073 ERR1225861 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 0 A horizon 3.0 0.4 0.0 5.5 7.9 26.6
JS051F JS051 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039737 SAMEA3732588 ERX1298074 ERR1225862 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 O horizon 47.0 43.1 1.1 3.9 7.9 38.9
JS052F JS052 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039738 SAMEA3732589 ERX1298075 ERR1225863 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 A horizon 13.0 0.6 0.0 5.3 7.9 26.0
JS053F JS053 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039739 SAMEA3732590 ERX1298076 ERR1225864 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 O horizon 48.0 43.1 1.1 3.9 7.9 38.9
JS054F JS054 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039740 SAMEA3732591 ERX1298077 ERR1225865 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 A horizon 7.0 0.6 0.0 5.3 7.9 26.0
JS058F JS058 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039741 SAMEA3732592 ERX1298078 ERR1225866 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 0 A horizon 12.0 12.7 0.3 5.1 7.9 31.3
JS059F JS059 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039742 SAMEA3732593 ERX1298079 ERR1225867 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 O horizon 45.0 42.7 1.0 4.0 7.9 42.6
JS060F JS060 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039743 SAMEA3732594 ERX1298080 ERR1225868 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 A horizon 18.0 1.2 0.1 5.3 7.9 25.6
JS061F JS061 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039744 SAMEA3732595 ERX1298081 ERR1225869 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 O horizon 42.0 42.7 1.0 4.0 7.9 42.6
JS062F JS062 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039745 SAMEA3732596 ERX1298082 ERR1225870 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 A horizon 7.0 1.2 0.1 5.3 7.9 25.6
JS063F JS063 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039746 SAMEA3732597 ERX1298083 ERR1225871 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 O horizon 28.0 46.5 1.2 4.1 7.9 40.7
JS064F JS064 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039747 SAMEA3732598 ERX1298084 ERR1225872 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 A horizon 6.0 1.0 0.0 5.2 7.9 24.1
JS065F JS065 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039748 SAMEA3732599 ERX1298085 ERR1225873 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 O horizon 36.0 46.5 1.2 4.1 7.9 40.7
JS066F JS066 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039749 SAMEA3732600 ERX1298086 ERR1225874 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 A horizon 8.0 1.0 0.0 5.2 7.9 24.1
JS067F JS067 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039750 SAMEA3732601 ERX1298087 ERR1225875 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 O horizon 29.0 42.1 0.9 3.9 7.9 46.1
JS068F JS068 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039751 SAMEA3732602 ERX1298088 ERR1225876 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 A horizon 14.0 0.8 0.0 5.2 7.9 26.8
JS072F JS072 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039752 SAMEA3732603 ERX1298089 ERR1225877 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 1 A horizon 9.0 0.4 0.0 5.3 7.9 24.1
JS074F JS074 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039753 SAMEA3732604 ERX1298090 ERR1225878 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 0 A horizon 6.0 0.4 0.0 5.3 7.9 24.1
JS075F JS075 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039754 SAMEA3732605 ERX1298091 ERR1225879 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 O horizon 32.0 43.4 1.1 3.9 7.9 40.0
JS076F JS076 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039755 SAMEA3732606 ERX1298092 ERR1225880 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 A horizon 6.0 0.8 0.0 5.3 7.9 23.0
JS077F JS077 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039756 SAMEA3732607 ERX1298093 ERR1225881 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 O horizon 34.0 43.4 1.1 3.9 7.9 40.0
JS078F JS078 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039757 SAMEA3732608 ERX1298094 ERR1225882 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 A horizon 4.0 0.8 0.0 5.3 7.9 23.0
JS079F JS079 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039758 SAMEA3732609 ERX1298095 ERR1225883 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 O horizon 47.0 45.7 1.3 3.7 7.9 36.6
JS080F JS080 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039759 SAMEA3732610 ERX1298096 ERR1225884 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 A horizon 16.0 1.0 0.1 5.2 7.9 16.4
JS081F JS081 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039760 SAMEA3732611 ERX1298097 ERR1225885 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 O horizon 45.0 44.8 1.3 3.8 7.8 34.7
JS082F JS082 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039761 SAMEA3732612 ERX1298098 ERR1225886 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 A horizon 17.0 1.0 0.0 5.1 7.8 23.8
JS083F JS083 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039762 SAMEA3732613 ERX1298099 ERR1225887 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 O horizon 49.0 44.6 1.2 3.6 7.8 35.9
JS084F JS084 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039763 SAMEA3732614 ERX1298100 ERR1225888 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 A horizon 12.0 1.2 0.1 5.0 7.8 23.2
JW002F JW002 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039764 SAMEA3732615 ERX1298101 ERR1225889 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 1 A horizon 12.0 2.2 0.1 5.4 7.2 17.8
JW003F JW003 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039765 SAMEA3732616 ERX1298102 ERR1225890 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 O horizon 37.0 38.3 1.1 4.1 7.2 37.3
JW004F JW004 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039766 SAMEA3732617 ERX1298103 ERR1225891 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 A horizon 11.0 2.2 0.1 5.4 7.2 17.8
JW005F JW005 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039767 SAMEA3732618 ERX1298104 ERR1225892 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 O horizon 38.1 36.4 1.1 4.2 6.3 33.0
JW006F JW006 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039768 SAMEA3732619 ERX1298105 ERR1225893 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 A horizon 16.0 2.7 0.2 5.3 6.3 16.0
JW007F JW007 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039769 SAMEA3732620 ERX1298106 ERR1225894 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 O horizon 40.0 36.4 1.1 4.2 6.3 33.0
JW008F JW008 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039770 SAMEA3732621 ERX1298107 ERR1225895 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 A horizon 10.0 2.7 0.2 5.3 6.3 16.0
JW010F JW010 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039771 SAMEA3732622 ERX1298108 ERR1225896 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 1 A horizon 18.0 1.5 0.1 5.5 8.9 15.6
JW012F JW012 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039772 SAMEA3732623 ERX1298109 ERR1225897 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 A horizon 13.0 1.5 0.1 5.5 8.9 15.6
JW013F JW013 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039773 SAMEA3732624 ERX1298110 ERR1225898 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 O horizon 31.0 38.1 1.1 4.1 8.9 36.6
JW014F JW014 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039774 SAMEA3732625 ERX1298111 ERR1225899 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 A horizon 16.0 1.5 0.1 5.5 8.9 15.6
JW017F JW017 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039775 SAMEA3732626 ERX1298112 ERR1225900 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 O horizon 47.0 36.9 1.2 4.2 9.8 30.8
JW020F JW020 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039776 SAMEA3732627 ERX1298113 ERR1225901 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 A horizon 12.0 2.6 0.2 5.4 9.8 16.2
JW022F JW022 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039777 SAMEA3732628 ERX1298114 ERR1225902 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 A horizon 14.0 3.1 0.2 5.3 7.7 14.8
JW023F JW023 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039778 SAMEA3732629 ERX1298115 ERR1225903 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 O horizon 47.0 34.6 1.1 4.1 7.7 30.1
JW024F JW024 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039779 SAMEA3732630 ERX1298116 ERR1225904 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 A horizon 12.0 3.1 0.2 5.3 7.7 14.8
JW025F JW025 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039780 SAMEA3732631 ERX1298117 ERR1225905 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 O horizon 40.0 34.6 1.1 4.1 7.7 30.1
JW027F JW027 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039781 SAMEA3732632 ERX1298118 ERR1225906 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 O horizon 34.0 33.8 1.0 4.4 6.3 32.8
JW029F JW029 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039782 SAMEA3732633 ERX1298119 ERR1225907 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 O horizon 57.0 33.8 1.0 4.4 6.3 32.8
JW030F JW030 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039783 SAMEA3732634 ERX1298120 ERR1225908 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 A horizon 14.0 3.3 0.3 5.3 6.3 13.6
JW031F JW031 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039784 SAMEA3732635 ERX1298121 ERR1225909 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 O horizon 40.0 37.6 1.1 4.0 7.7 33.6
JW032F JW032 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039785 SAMEA3732636 ERX1298122 ERR1225910 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 A horizon 17.0 3.0 0.4 5.1 7.7 13.9
JW033F JW033 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039786 SAMEA3732637 ERX1298123 ERR1225911 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 O horizon 60.0 37.6 1.1 4.0 7.7 33.6
JW034F JW034 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039787 SAMEA3732638 ERX1298124 ERR1225912 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 A horizon 16.0 3.0 0.4 5.1 7.7 13.9
JW035F JW035 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039788 SAMEA3732639 ERX1298125 ERR1225913 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.1 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 O horizon 46.0 35.2 1.1 4.3 9.7 32.5
JW036F JW036 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039789 SAMEA3732640 ERX1298126 ERR1225914 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 A horizon 13.0 2.7 0.5 5.4 9.7 11.1
JW038F JW038 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039790 SAMEA3732641 ERX1298127 ERR1225915 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 A horizon 13.0 2.7 0.5 5.4 9.7 11.1
JW040F JW040 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039791 SAMEA3732642 ERX1298128 ERR1225916 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 1 A horizon 19.0 1.3 0.6 5.4 9.0 9.8
JW042F JW042 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039792 SAMEA3732643 ERX1298129 ERR1225917 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-07-07 46.42 -83.37 Canada 0.3 228 NA 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 A horizon 14.0 1.3 0.6 5.4 9.0 9.8
LH001F LH001 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039793 SAMEA3732644 ERX1298130 ERR1225918 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 14.0 NA NA 3.7 NA NA
LH002F LH002 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039794 SAMEA3732645 ERX1298131 ERR1225919 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 19.0 3.1 0.1 5.2 NA 24.8
LH003F LH003 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039795 SAMEA3732646 ERX1298132 ERR1225920 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 17.0 NA NA 3.6 NA NA
LH004F LH004 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039796 SAMEA3732647 ERX1298133 ERR1225921 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 34.0 3.1 0.1 5.3 NA 24.8
LH005F LH005 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039797 SAMEA3732648 ERX1298134 ERR1225922 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 15.0 NA NA 3.9 NA NA
LH006F LH006 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039798 SAMEA3732649 ERX1298135 ERR1225923 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 19.0 3.1 0.1 5.5 NA 24.8
LH007F LH007 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039799 SAMEA3732650 ERX1298136 ERR1225924 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 10.0 NA NA 4.6 NA NA
LH009F LH009 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039800 SAMEA3732651 ERX1298137 ERR1225925 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 34.0 NA NA 4.5 NA NA
LH010F LH010 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039801 SAMEA3732652 ERX1298138 ERR1225926 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 18.0 3.6 0.2 5.9 NA 22.3
LH011F LH011 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039802 SAMEA3732653 ERX1298139 ERR1225927 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 7.0 NA NA 4.2 NA NA
LH012F LH012 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039803 SAMEA3732654 ERX1298140 ERR1225928 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 18.0 3.6 0.2 5.7 NA 22.3
LH014F LH014 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039804 SAMEA3732655 ERX1298141 ERR1225929 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 17.0 3.3 0.2 5.0 NA 21.6
LH015F LH015 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039805 SAMEA3732656 ERX1298142 ERR1225930 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 14.0 NA NA 5.8 NA NA
LH016F LH016 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039806 SAMEA3732657 ERX1298143 ERR1225931 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 17.0 3.3 0.2 6.3 NA 21.6
LH018F LH018 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039807 SAMEA3732658 ERX1298144 ERR1225932 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 16.0 3.3 0.2 6.0 NA 21.6
LH019F LH019 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039808 SAMEA3732659 ERX1298145 ERR1225933 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 22.0 NA NA 5.6 NA NA
LH021F LH021 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039809 SAMEA3732660 ERX1298146 ERR1225934 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 14.0 NA NA 4.9 NA NA
LH022F LH022 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039810 SAMEA3732661 ERX1298147 ERR1225935 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 19.0 3.9 0.2 6.1 NA 26.0
LH023F LH023 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039811 SAMEA3732662 ERX1298148 ERR1225936 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 13.0 NA NA 5.7 NA NA
LH024F LH024 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039812 SAMEA3732663 ERX1298149 ERR1225937 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 19.0 3.9 0.2 6.5 NA 26.0
OC362F OC362 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039814 SAMEA3732665 ERX1298151 ERR1225939 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 46.0 NA NA 0.0 NA NA
OC363F OC363 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039815 SAMEA3732666 ERX1298152 ERR1225940 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 54.0 NA NA 0.0 NA NA
OC364F OC364 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039816 SAMEA3732667 ERX1298153 ERR1225941 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 12.0 NA NA 0.0 NA NA
OC365F OC365 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039817 SAMEA3732668 ERX1298154 ERR1225942 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 13.0 NA NA 0.0 NA NA
OC366F OC366 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039818 SAMEA3732669 ERX1298155 ERR1225943 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 19.0 NA NA 0.0 NA NA
OC367F OC367 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039819 SAMEA3732670 ERX1298156 ERR1225944 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 57.0 NA NA 0.0 NA NA
OC368F OC368 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039820 SAMEA3732671 ERX1298157 ERR1225945 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 57.0 NA NA 0.0 NA NA
OC369F OC369 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039821 SAMEA3732672 ERX1298158 ERR1225946 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 61.0 NA NA 0.0 NA NA
OC371F OC371 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039822 SAMEA3732673 ERX1298159 ERR1225947 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 20.0 NA NA 0.0 NA NA
OC372F OC372 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039823 SAMEA3732674 ERX1298160 ERR1225948 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 22.0 NA NA 0.0 NA NA
OC374F OC374 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039824 SAMEA3732675 ERX1298161 ERR1225949 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 59.0 NA NA 0.0 NA NA
OC375F OC375 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039825 SAMEA3732676 ERX1298162 ERR1225950 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 60.0 NA NA 0.0 NA NA
OC376F OC376 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039826 SAMEA3732677 ERX1298163 ERR1225951 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 20.0 NA NA 0.0 NA NA
OC377F OC377 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039827 SAMEA3732678 ERX1298164 ERR1225952 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 21.0 NA NA 0.0 NA NA
OC378F OC378 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039828 SAMEA3732679 ERX1298165 ERR1225953 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 21.0 NA NA 0.0 NA NA
OC379F OC379 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039829 SAMEA3732680 ERX1298166 ERR1225954 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 23.0 NA NA 0.0 NA NA
OC381F OC381 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039830 SAMEA3732681 ERX1298167 ERR1225955 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 16.0 NA NA 0.0 NA NA
TXA001F TXA001 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039831 SAMEA3732682 ERX1298168 ERR1225956 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.0 1.1 0.1 5.0 1.3 18.5
TXA003F TXA003 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039832 SAMEA3732683 ERX1298169 ERR1225957 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.0 1.1 0.1 4.6 1.3 18.5
TXA004F TXA004 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039833 SAMEA3732684 ERX1298170 ERR1225958 ITS ITS2 TCGCACTAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 4.7 NA NA
TXA005F TXA005 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039834 SAMEA3732685 ERX1298171 ERR1225959 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 4.7 NA NA
TXA008F TXA008 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039835 SAMEA3732686 ERX1298172 ERR1225960 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 1.1 0.1 4.8 1.3 18.5
TXA009F TXA009 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039836 SAMEA3732687 ERX1298173 ERR1225961 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 1.1 0.1 5.1 1.3 18.5
TXA010F TXA010 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039837 SAMEA3732688 ERX1298174 ERR1225962 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 4.8 NA NA
TXA012F TXA012 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039838 SAMEA3732689 ERX1298175 ERR1225963 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 4.8 NA NA
TXA015F TXA015 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039839 SAMEA3732690 ERX1298176 ERR1225964 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 0.0 1.2 0.1 4.3 1.3 23.9
TXA016F TXA016 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039840 SAMEA3732691 ERX1298177 ERR1225965 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 4.5 NA NA
TXA017F TXA017 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039841 SAMEA3732692 ERX1298178 ERR1225966 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 5.7 NA NA
TXA019F TXA019 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039842 SAMEA3732693 ERX1298179 ERR1225967 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 1.2 0.1 4.6 1.3 23.9
TXA021F TXA021 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039843 SAMEA3732694 ERX1298180 ERR1225968 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 1.2 0.1 5.1 1.3 23.9
TXA022F TXA022 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039844 SAMEA3732695 ERX1298181 ERR1225969 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.5 NA NA
TXA023F TXA023 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039845 SAMEA3732696 ERX1298182 ERR1225970 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.1 NA NA
TXA024F TXA024 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039846 SAMEA3732697 ERX1298183 ERR1225971 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 1.0 NA NA 4.6 NA NA
TXA025F TXA025 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039847 SAMEA3732698 ERX1298184 ERR1225972 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 0.0 0.8 0.0 4.6 1.3 17.8
TXA027F TXA027 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039848 SAMEA3732699 ERX1298185 ERR1225973 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 0.0 0.8 0.0 4.4 1.3 17.8
TXA030F TXA030 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039849 SAMEA3732700 ERX1298186 ERR1225974 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 0.0 NA NA 4.4 NA NA
TXA031F TXA031 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039850 SAMEA3732701 ERX1298187 ERR1225975 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 0.0 0.8 0.0 5.3 1.3 17.8
TXA032F TXA032 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039851 SAMEA3732702 ERX1298188 ERR1225976 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 0.0 0.8 0.0 4.6 1.3 17.8
TXA033F TXA033 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039852 SAMEA3732703 ERX1298189 ERR1225977 ITS ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 0.0 0.8 0.0 4.5 1.3 17.8
TXA034F TXA034 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039853 SAMEA3732704 ERX1298190 ERR1225978 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.5 NA NA
TXA036F TXA036 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039854 SAMEA3732705 ERX1298191 ERR1225979 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.5 NA NA
TXA037F TXA037 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039855 SAMEA3732706 ERX1298192 ERR1225980 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 0.0 NA NA 0.0 NA NA
TXA038F TXA038 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039856 SAMEA3732707 ERX1298193 ERR1225981 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 0.0 NA NA 0.0 NA NA
TXA040F TXA040 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039857 SAMEA3732708 ERX1298194 ERR1225982 ITS ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 0.0 NA NA 4.7 NA NA
TXA041F TXA041 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039858 SAMEA3732709 ERX1298195 ERR1225983 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 0.0 NA NA 4.4 NA NA
TXB043F TXB043 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039859 SAMEA3732710 ERX1298196 ERR1225984 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.0 0.9 0.1 5.1 1.3 15.5
TXB045F TXB045 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039860 SAMEA3732711 ERX1298197 ERR1225985 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.0 0.9 0.1 4.9 1.3 15.5
TXB046F TXB046 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039861 SAMEA3732712 ERX1298198 ERR1225986 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 5.0 NA NA
TXB047F TXB047 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039862 SAMEA3732713 ERX1298199 ERR1225987 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 4.9 NA NA
TXB048F TXB048 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039863 SAMEA3732714 ERX1298200 ERR1225988 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 5.0 NA NA
TXB049F TXB049 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039864 SAMEA3732715 ERX1298201 ERR1225989 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 0.9 0.1 5.0 1.3 15.5
TXB050F TXB050 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039865 SAMEA3732716 ERX1298202 ERR1225990 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 0.9 0.1 4.7 1.3 15.5
TXB051F TXB051 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039866 SAMEA3732717 ERX1298203 ERR1225991 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 0.9 0.1 4.8 1.3 15.5
TXB052F TXB052 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039867 SAMEA3732718 ERX1298204 ERR1225992 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 5.3 NA NA
TXB054F TXB054 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039868 SAMEA3732719 ERX1298205 ERR1225993 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 4.9 NA NA
TXB055F TXB055 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039869 SAMEA3732720 ERX1298206 ERR1225994 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 0.0 1.0 0.1 5.6 1.2 19.4
TXB056F TXB056 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039870 SAMEA3732721 ERX1298207 ERR1225995 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 0.0 1.0 0.1 5.4 1.2 19.4
TXB057F TXB057 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039871 SAMEA3732722 ERX1298208 ERR1225996 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 0.0 1.0 0.1 5.6 1.2 19.4
TXB060F TXB060 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039872 SAMEA3732723 ERX1298209 ERR1225997 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 5.1 NA NA
TXB061F TXB061 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039873 SAMEA3732724 ERX1298210 ERR1225998 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 1.0 0.1 5.0 1.2 19.4
TXB063F TXB063 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039874 SAMEA3732725 ERX1298211 ERR1225999 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 1.0 0.1 4.8 1.2 19.4
TXB064F TXB064 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039875 SAMEA3732726 ERX1298212 ERR1226000 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.4 NA NA
TXB065F TXB065 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039876 SAMEA3732727 ERX1298213 ERR1226001 ITS ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 5.0 NA NA
TXB066F TXB066 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039877 SAMEA3732728 ERX1298214 ERR1226002 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.7 NA NA
TXB067F TXB067 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039878 SAMEA3732729 ERX1298215 ERR1226003 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 0.0 1.0 0.1 4.5 1.3 20.1
TXB070F TXB070 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039879 SAMEA3732730 ERX1298216 ERR1226004 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 0.0 NA NA 4.3 NA NA
TXB071F TXB071 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039880 SAMEA3732731 ERX1298217 ERR1226005 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 0.0 NA NA 4.5 NA NA
TXB073F TXB073 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039881 SAMEA3732732 ERX1298218 ERR1226006 ITS ITS2 ATATCGCGAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 0.0 1.0 0.1 5.0 1.3 20.1
TXB076F TXB076 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039882 SAMEA3732733 ERX1298219 ERR1226007 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.3 NA NA
TXB077F TXB077 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039883 SAMEA3732734 ERX1298220 ERR1226008 ITS ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.4 NA NA
TXB078F TXB078 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039884 SAMEA3732735 ERX1298221 ERR1226009 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.3 NA NA
TXB079F TXB079 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039885 SAMEA3732736 ERX1298222 ERR1226010 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 0.0 NA NA 0.0 NA NA
TXB080F TXB080 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039886 SAMEA3732737 ERX1298223 ERR1226011 ITS ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 0.0 NA NA 0.0 NA NA
TXB081F TXB081 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039887 SAMEA3732738 ERX1298224 ERR1226012 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 0.0 NA NA 0.0 NA NA
TXB082F TXB082 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039888 SAMEA3732739 ERX1298225 ERR1226013 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 0.0 NA NA 4.5 NA NA
TXB083F TXB083 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039889 SAMEA3732740 ERX1298226 ERR1226014 ITS ITS2 AGACTATACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 0.0 NA NA 4.4 NA NA
TXB084F TXB084 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039890 SAMEA3732741 ERX1298227 ERR1226015 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 0.0 NA NA 4.9 NA NA
TXB085F TXB085 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039891 SAMEA3732742 ERX1298228 ERR1226016 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.1 0.9 0.1 5.0 1.3 17.4
TXB086F TXB086 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039892 SAMEA3732743 ERX1298229 ERR1226017 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.1 0.9 0.1 4.7 1.3 17.4
TXB087F TXB087 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039893 SAMEA3732744 ERX1298230 ERR1226018 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.1 0.9 0.1 5.0 1.3 17.4
TXB090F TXB090 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039894 SAMEA3732745 ERX1298231 ERR1226019 ITS ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.4 NA NA 5.3 NA NA
TXB091F TXB091 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039895 SAMEA3732746 ERX1298232 ERR1226020 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.1 0.9 0.1 5.2 1.3 17.4
TXB093F TXB093 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039896 SAMEA3732747 ERX1298233 ERR1226021 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.1 0.9 0.1 5.4 1.3 17.4
TXB095F TXB095 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039897 SAMEA3732748 ERX1298234 ERR1226022 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 4.5 NA NA
TXB096F TXB096 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039898 SAMEA3732749 ERX1298235 ERR1226023 ITS ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.3 NA NA 5.0 NA NA
TXC099F TXC099 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039900 SAMEA3732751 ERX1298237 ERR1226025 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 0.0 0.9 0.1 5.9 1.3 17.4
TXC100F TXC100 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039901 SAMEA3732752 ERX1298238 ERR1226026 ITS ITS2 AGCACTGTAG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 4.3 NA NA
TXC101F TXC101 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039902 SAMEA3732753 ERX1298239 ERR1226027 ITS ITS2 CGACGTGACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 4.8 NA NA
TXC102F TXC102 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039903 SAMEA3732754 ERX1298240 ERR1226028 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 4.6 NA NA
TXC103F TXC103 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039904 SAMEA3732755 ERX1298241 ERR1226029 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 0.8 0.0 4.4 1.3 15.7
TXC104F TXC104 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039905 SAMEA3732756 ERX1298242 ERR1226030 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 0.8 0.0 4.5 1.3 15.7
TXC105F TXC105 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039906 SAMEA3732757 ERX1298243 ERR1226031 ITS ITS2 TCGCACTAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.1 0.8 0.0 4.5 1.3 15.7
TXC106F TXC106 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039907 SAMEA3732758 ERX1298244 ERR1226032 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.6 NA NA
TXC107F TXC107 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039908 SAMEA3732759 ERX1298245 ERR1226033 ITS ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.5 NA NA
TXC109F TXC109 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039909 SAMEA3732760 ERX1298246 ERR1226034 ITS ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.0 0.8 0.0 4.8 1.3 16.3
TXC110F TXC110 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039910 SAMEA3732761 ERX1298247 ERR1226035 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.0 0.8 0.0 4.9 1.3 16.3
TXC111F TXC111 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039911 SAMEA3732762 ERX1298248 ERR1226036 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 0.0 0.8 0.0 5.0 1.3 16.3
TXC112F TXC112 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039912 SAMEA3732763 ERX1298249 ERR1226037 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 4.5 NA NA
TXC113F TXC113 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039913 SAMEA3732764 ERX1298250 ERR1226038 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 4.4 NA NA
TXC114F TXC114 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039914 SAMEA3732765 ERX1298251 ERR1226039 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 0.0 NA NA 5.3 NA NA
TXC115F TXC115 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039915 SAMEA3732766 ERX1298252 ERR1226040 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 0.8 0.0 5.3 1.3 16.3
TXC116F TXC116 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039916 SAMEA3732767 ERX1298253 ERR1226041 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 0.8 0.0 4.7 1.3 16.3
TXC117F TXC117 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039917 SAMEA3732768 ERX1298254 ERR1226042 ITS ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 0.0 0.8 0.0 5.2 1.3 16.3
TXC118F TXC118 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039918 SAMEA3732769 ERX1298255 ERR1226043 ITS ITS2 TACACACACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 4.2 NA NA
TXC119F TXC119 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039919 SAMEA3732770 ERX1298256 ERR1226044 ITS ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 4.5 NA NA
TXC120F TXC120 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039920 SAMEA3732771 ERX1298257 ERR1226045 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 0.0 NA NA 4.3 NA NA
TXC122F TXC122 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039921 SAMEA3732772 ERX1298258 ERR1226046 ITS ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 0.0 0.7 0.0 4.7 1.4 15.7
TXC124F TXC124 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039922 SAMEA3732773 ERX1298259 ERR1226047 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 4.2 NA NA
TXC125F TXC125 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039923 SAMEA3732774 ERX1298260 ERR1226048 ITS ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 4.3 NA NA
TXC126F TXC126 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039924 SAMEA3732775 ERX1298261 ERR1226049 ITS ITS2 ACGCTCGACA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 0.0 NA NA 5.2 NA NA
TXC127F TXC127 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039925 SAMEA3732776 ERX1298262 ERR1226050 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 0.7 0.0 5.0 1.4 15.7
TXC128F TXC128 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039926 SAMEA3732777 ERX1298263 ERR1226051 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 0.7 0.0 5.1 1.4 15.7
TXC129F TXC129 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039927 SAMEA3732778 ERX1298264 ERR1226052 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 0.0 0.7 0.0 5.1 1.4 15.7
TXC130F TXC130 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039928 SAMEA3732779 ERX1298265 ERR1226053 ITS ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.4 NA NA
TXC132F TXC132 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039929 SAMEA3732780 ERX1298266 ERR1226054 ITS ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 0.0 NA NA 4.1 NA NA
TXC133F TXC133 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039930 SAMEA3732781 ERX1298267 ERR1226055 ITS ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 0.0 0.7 0.0 4.3 1.3 16.4
TXC135F TXC135 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039931 SAMEA3732782 ERX1298268 ERR1226056 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 0.0 0.7 0.0 4.6 1.3 16.4
TXC137F TXC137 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039932 SAMEA3732783 ERX1298269 ERR1226057 ITS ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 0.0 NA NA 4.8 NA NA
TXC138F TXC138 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039933 SAMEA3732784 ERX1298270 ERR1226058 ITS ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 0.0 NA NA 4.8 NA NA
TXC139F TXC139 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039934 SAMEA3732785 ERX1298271 ERR1226059 ITS ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 0.0 0.7 0.0 4.4 1.3 16.4
TXC140F TXC140 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039935 SAMEA3732786 ERX1298272 ERR1226060 ITS ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 0.0 0.7 0.0 4.5 1.3 16.4
TXC142F TXC142 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039936 SAMEA3732787 ERX1298273 ERR1226061 ITS ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.1 NA NA
TXC143F TXC143 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039937 SAMEA3732788 ERX1298274 ERR1226062 ITS ITS2 AGACGCACTC TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.3 NA NA
TXC144F TXC144 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039938 SAMEA3732789 ERX1298275 ERR1226063 ITS ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 0.0 NA NA 4.3 NA NA
TXC146F TXC146 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039939 SAMEA3732790 ERX1298276 ERR1226064 ITS ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 0.0 NA NA 0.0 NA NA
TXC148F TXC148 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039940 SAMEA3732791 ERX1298277 ERR1226065 ITS ITS2 ATCAGACACG TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 0.0 NA NA 4.1 NA NA
TXC149F TXC149 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039941 SAMEA3732792 ERX1298278 ERR1226066 ITS ITS2 ACGAGTGCGT TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 0.0 NA NA 4.7 NA NA
BP241F BP241 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039942 SAMEA3732793 ERX1298279 ERR1226067 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 88.0 2.5 0.1 5.5 1.4 22.8
BP242F BP242 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039943 SAMEA3732794 ERX1298280 ERR1226068 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 90.0 2.5 0.1 5.5 1.4 22.8
BP243F BP243 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039944 SAMEA3732795 ERX1298281 ERR1226069 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 93.0 2.5 0.1 5.5 1.4 22.8
BP244F BP244 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039945 SAMEA3732796 ERX1298282 ERR1226070 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 40.0 41.8 1.5 5.8 1.4 27.7
BP245F BP245 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039946 SAMEA3732797 ERX1298283 ERR1226071 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 50.0 41.8 1.5 5.8 1.4 27.7
BP246F BP246 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039947 SAMEA3732798 ERX1298284 ERR1226072 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 39.0 41.8 1.5 5.8 1.4 27.7
BP250F BP250 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039948 SAMEA3732799 ERX1298285 ERR1226073 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 53.0 2.0 0.1 5.6 1.5 22.3
BP251F BP251 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039949 SAMEA3732800 ERX1298286 ERR1226074 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 50.0 2.0 0.1 5.6 1.5 22.3
BP252F BP252 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039950 SAMEA3732801 ERX1298287 ERR1226075 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 38.0 2.0 0.1 5.6 1.5 22.3
BP256F BP256 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039951 SAMEA3732802 ERX1298288 ERR1226076 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 45.0 2.6 0.1 5.7 1.5 23.6
BP257F BP257 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039952 SAMEA3732803 ERX1298289 ERR1226077 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 55.0 2.6 0.1 5.7 1.5 23.6
BP258F BP258 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039953 SAMEA3732804 ERX1298290 ERR1226078 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 46.0 2.6 0.1 5.7 1.5 23.6
BP259F BP259 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039954 SAMEA3732805 ERX1298291 ERR1226079 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 88.0 38.7 1.1 5.6 1.0 35.2
BP260F BP260 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039955 SAMEA3732806 ERX1298292 ERR1226080 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 88.0 38.7 1.1 5.6 1.0 35.2
BP261F BP261 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039956 SAMEA3732807 ERX1298293 ERR1226081 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 83.0 38.7 1.1 5.6 1.0 35.2
BP262F BP262 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039957 SAMEA3732808 ERX1298294 ERR1226082 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 43.0 3.0 0.1 5.4 1.0 27.1
BP263F BP263 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039958 SAMEA3732809 ERX1298295 ERR1226083 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 48.0 3.0 0.1 5.4 1.0 27.1
BP264F BP264 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039959 SAMEA3732810 ERX1298296 ERR1226084 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 47.0 3.0 0.1 5.4 1.0 27.1
BP265F BP265 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039960 SAMEA3732811 ERX1298297 ERR1226085 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 79.0 43.2 0.9 5.1 1.1 50.9
BP266F BP266 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039961 SAMEA3732812 ERX1298298 ERR1226086 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 83.0 43.2 0.9 5.1 1.1 50.9
BP267F BP267 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039962 SAMEA3732813 ERX1298299 ERR1226087 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 79.0 43.2 0.9 5.1 1.1 50.9
BP268F BP268 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039963 SAMEA3732814 ERX1298300 ERR1226088 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 44.0 2.8 0.1 5.4 1.1 27.6
BP269F BP269 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039964 SAMEA3732815 ERX1298301 ERR1226089 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 47.0 2.8 0.1 5.4 1.1 27.6
BP270F BP270 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039965 SAMEA3732816 ERX1298302 ERR1226090 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 51.0 2.8 0.1 5.4 1.1 27.6
BP271F BP271 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039966 SAMEA3732817 ERX1298303 ERR1226091 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 89.0 38.6 1.0 5.3 1.3 37.5
BP272F BP272 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039967 SAMEA3732818 ERX1298304 ERR1226092 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 83.0 38.6 1.0 5.3 1.3 37.5
BP273F BP273 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039968 SAMEA3732819 ERX1298305 ERR1226093 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 88.0 38.6 1.0 5.3 1.3 37.5
BP274F BP274 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039969 SAMEA3732820 ERX1298306 ERR1226094 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 43.0 2.7 0.1 5.5 1.3 24.2
BP275F BP275 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039970 SAMEA3732821 ERX1298307 ERR1226095 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 50.0 2.7 0.1 5.5 1.3 24.2
BP276F BP276 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039971 SAMEA3732822 ERX1298308 ERR1226096 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 44.0 2.7 0.1 5.5 1.3 24.2
BP277F BP277 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039972 SAMEA3732823 ERX1298309 ERR1226097 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 87.0 33.4 0.9 5.2 1.2 38.4
BP278F BP278 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039973 SAMEA3732824 ERX1298310 ERR1226098 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 86.0 33.4 0.9 5.2 1.2 38.4
BP279F BP279 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039974 SAMEA3732825 ERX1298311 ERR1226099 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 75.0 33.4 0.9 5.2 1.2 38.4
BP280F BP280 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039975 SAMEA3732826 ERX1298312 ERR1226100 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 53.0 2.1 0.1 5.3 1.2 22.9
BP281F BP281 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039976 SAMEA3732827 ERX1298313 ERR1226101 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 51.0 2.1 0.1 5.3 1.2 22.9
BP282F BP282 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039977 SAMEA3732828 ERX1298314 ERR1226102 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 45.0 2.1 0.1 5.3 1.2 22.9
BP286F BP286 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039978 SAMEA3732829 ERX1298315 ERR1226103 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 42.0 2.1 0.1 5.7 1.3 23.3
BP287F BP287 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039979 SAMEA3732830 ERX1298316 ERR1226104 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 48.0 2.1 0.1 5.7 1.3 23.3
BP288F BP288 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039980 SAMEA3732831 ERX1298317 ERR1226105 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 47.0 2.1 0.1 5.7 1.3 23.3
BP289F BP289 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039981 SAMEA3732832 ERX1298318 ERR1226106 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 80.0 37.6 0.9 5.1 1.4 41.4
BP290F BP290 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039982 SAMEA3732833 ERX1298319 ERR1226107 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 87.0 37.6 0.9 5.1 1.4 41.4
BP291F BP291 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039983 SAMEA3732834 ERX1298320 ERR1226108 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 80.0 37.6 0.9 5.1 1.4 41.4
BP292F BP292 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039984 SAMEA3732835 ERX1298321 ERR1226109 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 47.0 3.6 0.2 5.7 1.4 23.7
BP293F BP293 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039985 SAMEA3732836 ERX1298322 ERR1226110 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 49.0 3.6 0.2 5.7 1.4 23.7
BP294F BP294 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039986 SAMEA3732837 ERX1298323 ERR1226111 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 42.0 3.6 0.2 5.7 1.4 23.7
BP295F BP295 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039987 SAMEA3732838 ERX1298324 ERR1226112 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 74.0 44.4 1.3 5.4 NA 35.5
BP296F BP296 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039988 SAMEA3732839 ERX1298325 ERR1226113 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 88.0 44.4 1.3 5.4 NA 35.5
BP297F BP297 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039989 SAMEA3732840 ERX1298326 ERR1226114 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 84.0 44.4 1.3 5.4 NA 35.5
BP298F BP298 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039990 SAMEA3732841 ERX1298327 ERR1226115 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 46.0 2.4 0.1 5.6 NA 24.2
BP299F BP299 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039991 SAMEA3732842 ERX1298328 ERR1226116 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 44.0 2.4 0.1 5.6 NA 24.2
BP300F BP300 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039992 SAMEA3732843 ERX1298329 ERR1226117 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 45.0 2.4 0.1 5.6 NA 24.2
DC184F DC184 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039993 SAMEA3732844 ERX1298330 ERR1226118 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 20.0 1.7 0.1 5.9 1.5 18.4
DC185F DC185 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039994 SAMEA3732845 ERX1298331 ERR1226119 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 26.0 1.7 0.1 5.9 1.5 18.4
DC186F DC186 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039995 SAMEA3732846 ERX1298332 ERR1226120 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 20.0 1.7 0.1 5.9 1.5 18.4
DC187F DC187 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039996 SAMEA3732847 ERX1298333 ERR1226121 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 58.0 32.9 1.3 6.0 1.3 25.1
DC188F DC188 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039997 SAMEA3732848 ERX1298334 ERR1226122 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 63.0 32.9 1.3 6.0 1.3 25.1
DC189F DC189 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039998 SAMEA3732849 ERX1298335 ERR1226123 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 56.0 32.9 1.3 6.0 1.3 25.1
DC190F DC190 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1039999 SAMEA3732850 ERX1298336 ERR1226124 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 21.0 3.3 0.2 5.6 1.3 20.5
DC191F DC191 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040000 SAMEA3732851 ERX1298337 ERR1226125 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 23.0 3.3 0.2 5.6 1.3 20.5
DC192F DC192 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040001 SAMEA3732852 ERX1298338 ERR1226126 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 25.0 3.3 0.2 5.6 1.3 20.5
DC193F DC193 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040002 SAMEA3732853 ERX1298339 ERR1226127 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 61.0 32.9 1.2 5.8 1.5 28.4
DC194F DC194 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040003 SAMEA3732854 ERX1298340 ERR1226128 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 63.0 32.9 1.2 5.8 1.5 28.4
DC195F DC195 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040004 SAMEA3732855 ERX1298341 ERR1226129 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 57.0 32.9 1.2 5.8 1.5 28.4
DC196F DC196 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040005 SAMEA3732856 ERX1298342 ERR1226130 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 29.0 2.1 0.1 5.6 1.5 20.5
DC197F DC197 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040006 SAMEA3732857 ERX1298343 ERR1226131 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 27.0 2.1 0.1 5.6 1.5 20.5
DC198F DC198 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040007 SAMEA3732858 ERX1298344 ERR1226132 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 21.0 2.1 0.1 5.6 1.5 20.5
DC199F DC199 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040008 SAMEA3732859 ERX1298345 ERR1226133 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 58.0 30.1 1.0 5.8 1.5 29.3
DC200F DC200 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040009 SAMEA3732860 ERX1298346 ERR1226134 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 53.0 30.1 1.0 5.8 1.5 29.3
DC201F DC201 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040010 SAMEA3732861 ERX1298347 ERR1226135 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 59.0 30.1 1.0 5.8 1.5 29.3
DC202F DC202 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040011 SAMEA3732862 ERX1298348 ERR1226136 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 24.0 2.4 0.1 5.8 1.5 18.5
DC203F DC203 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040012 SAMEA3732863 ERX1298349 ERR1226137 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 33.0 2.4 0.1 5.8 1.5 18.5
DC204F DC204 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040013 SAMEA3732864 ERX1298350 ERR1226138 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 30.0 2.4 0.1 5.8 1.5 18.5
DC205F DC205 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040014 SAMEA3732865 ERX1298351 ERR1226139 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 60.0 38.7 1.3 5.6 1.4 29.5
DC206F DC206 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040015 SAMEA3732866 ERX1298352 ERR1226140 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 60.0 38.7 1.3 5.6 1.4 29.5
DC207F DC207 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040016 SAMEA3732867 ERX1298353 ERR1226141 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 58.0 38.7 1.3 5.6 1.4 29.5
DC208F DC208 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040017 SAMEA3732868 ERX1298354 ERR1226142 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 28.0 2.3 0.1 5.2 1.4 20.5
DC209F DC209 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040018 SAMEA3732869 ERX1298355 ERR1226143 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.0 2.3 0.1 5.2 1.4 20.5
DC210F DC210 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040019 SAMEA3732870 ERX1298356 ERR1226144 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 24.0 2.3 0.1 5.2 1.4 20.5
DC214F DC214 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040020 SAMEA3732871 ERX1298357 ERR1226145 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 17.0 1.8 0.1 5.7 1.7 19.7
DC215F DC215 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040021 SAMEA3732872 ERX1298358 ERR1226146 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 18.0 1.8 0.1 5.7 1.7 19.7
DC216F DC216 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040022 SAMEA3732873 ERX1298359 ERR1226147 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 25.0 1.8 0.1 5.7 1.7 19.7
DC220F DC220 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040023 SAMEA3732874 ERX1298360 ERR1226148 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 25.0 2.0 0.1 5.8 1.7 18.0
DC221F DC221 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040024 SAMEA3732875 ERX1298361 ERR1226149 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 25.0 2.0 0.1 5.8 1.7 18.0
DC222F DC222 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040025 SAMEA3732876 ERX1298362 ERR1226150 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 21.0 2.0 0.1 5.8 1.7 18.0
DC223F DC223 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040026 SAMEA3732877 ERX1298363 ERR1226151 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 63.0 38.8 1.0 5.5 1.5 39.2
DC224F DC224 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040027 SAMEA3732878 ERX1298364 ERR1226152 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 57.0 38.8 1.0 5.5 1.5 39.2
DC225F DC225 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040028 SAMEA3732879 ERX1298365 ERR1226153 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 63.0 38.8 1.0 5.5 1.5 39.2
DC226F DC226 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040029 SAMEA3732880 ERX1298366 ERR1226154 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 27.0 2.6 0.1 5.5 1.5 21.4
DC227F DC227 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040030 SAMEA3732881 ERX1298367 ERR1226155 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 26.0 2.6 0.1 5.5 1.5 21.4
DC228F DC228 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040031 SAMEA3732882 ERX1298368 ERR1226156 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 27.0 2.6 0.1 5.5 1.5 21.4
DC229F DC229 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040032 SAMEA3732883 ERX1298369 ERR1226157 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 60.0 36.7 1.1 5.9 1.4 33.3
DC230F DC230 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040033 SAMEA3732884 ERX1298370 ERR1226158 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 60.0 36.7 1.1 5.9 1.4 33.3
DC231F DC231 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040034 SAMEA3732885 ERX1298371 ERR1226159 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 52.0 36.7 1.1 5.9 1.4 33.3
DC232F DC232 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040035 SAMEA3732886 ERX1298372 ERR1226160 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 29.0 2.8 0.1 5.9 1.4 19.9
DC233F DC233 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040036 SAMEA3732887 ERX1298373 ERR1226161 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 29.0 2.8 0.1 5.9 1.4 19.9
DC234F DC234 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040037 SAMEA3732888 ERX1298374 ERR1226162 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 29.0 2.8 0.1 5.9 1.4 19.9
DC235F DC235 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040038 SAMEA3732889 ERX1298375 ERR1226163 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 63.0 44.3 1.1 5.0 NA 41.4
DC236F DC236 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040039 SAMEA3732890 ERX1298376 ERR1226164 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 64.0 44.3 1.1 5.0 NA 41.4
DC237F DC237 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040040 SAMEA3732891 ERX1298377 ERR1226165 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 60.0 44.3 1.1 5.0 NA 41.4
DC238F DC238 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040041 SAMEA3732892 ERX1298378 ERR1226166 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 25.0 2.3 0.1 5.2 NA 23.4
DC239F DC239 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040042 SAMEA3732893 ERX1298379 ERR1226167 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 27.0 2.3 0.1 5.2 NA 23.4
DC240F DC240 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040043 SAMEA3732894 ERX1298380 ERR1226168 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 34.0 2.3 0.1 5.2 NA 23.4
LL001F LL001 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040044 SAMEA3732895 ERX1298381 ERR1226169 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 42.0 24.3 0.8 4.7 1.4 30.8
LL002F LL002 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040045 SAMEA3732896 ERX1298382 ERR1226170 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 48.0 24.3 0.8 4.7 1.4 30.8
LL003F LL003 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040046 SAMEA3732897 ERX1298383 ERR1226171 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 40.0 24.3 0.8 4.7 1.4 30.8
LL004F LL004 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040047 SAMEA3732898 ERX1298384 ERR1226172 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 22.0 1.6 0.1 4.7 1.4 22.1
LL005F LL005 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040048 SAMEA3732899 ERX1298385 ERR1226173 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 20.0 1.6 0.1 4.7 1.4 22.1
LL006F LL006 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040049 SAMEA3732900 ERX1298386 ERR1226174 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 21.0 1.6 0.1 4.7 1.4 22.1
LL007F LL007 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040050 SAMEA3732901 ERX1298387 ERR1226175 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 48.0 27.6 0.8 4.5 1.6 33.7
LL008F LL008 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040051 SAMEA3732902 ERX1298388 ERR1226176 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 49.0 27.6 0.8 4.5 1.6 33.7
LL009F LL009 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040052 SAMEA3732903 ERX1298389 ERR1226177 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 40.0 27.6 0.8 4.5 1.6 33.7
LL010F LL010 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040053 SAMEA3732904 ERX1298390 ERR1226178 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 17.0 1.2 0.1 4.8 1.6 19.3
LL011F LL011 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040054 SAMEA3732905 ERX1298391 ERR1226179 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 19.0 1.2 0.1 4.8 1.6 19.3
LL012F LL012 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040055 SAMEA3732906 ERX1298392 ERR1226180 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 16.0 1.2 0.1 4.8 1.6 19.3
LL016F LL016 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040056 SAMEA3732907 ERX1298393 ERR1226181 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 23.0 1.7 0.1 5.1 1.3 20.9
LL017F LL017 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040057 SAMEA3732908 ERX1298394 ERR1226182 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 20.0 1.7 0.1 5.1 1.3 20.9
LL018F LL018 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040058 SAMEA3732909 ERX1298395 ERR1226183 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 21.0 1.7 0.1 5.1 1.3 20.9
LL019F LL019 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040059 SAMEA3732910 ERX1298396 ERR1226184 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 61.0 36.0 0.8 4.6 1.5 43.8
LL020F LL020 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040060 SAMEA3732911 ERX1298397 ERR1226185 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 46.0 36.0 0.8 4.6 1.5 43.8
LL021F LL021 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040061 SAMEA3732912 ERX1298398 ERR1226186 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 44.0 36.0 0.8 4.6 1.5 43.8
LL022F LL022 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040062 SAMEA3732913 ERX1298399 ERR1226187 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 17.0 1.2 0.1 4.6 1.5 23.4
LL023F LL023 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040063 SAMEA3732914 ERX1298400 ERR1226188 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 20.0 1.2 0.1 4.6 1.5 23.4
LL024F LL024 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040064 SAMEA3732915 ERX1298401 ERR1226189 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 19.0 1.2 0.1 4.6 1.5 23.4
LL025F LL025 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040065 SAMEA3732916 ERX1298402 ERR1226190 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 52.0 27.5 0.8 4.5 1.6 34.8
LL026F LL026 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040066 SAMEA3732917 ERX1298403 ERR1226191 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 55.0 27.5 0.8 4.5 1.6 34.8
LL027F LL027 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040067 SAMEA3732918 ERX1298404 ERR1226192 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 60.0 27.5 0.8 4.5 1.6 34.8
LL028F LL028 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040068 SAMEA3732919 ERX1298405 ERR1226193 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 20.0 1.5 0.1 4.9 1.6 21.1
LL029F LL029 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040069 SAMEA3732920 ERX1298406 ERR1226194 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 17.0 1.5 0.1 4.9 1.6 21.1
LL030F LL030 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040070 SAMEA3732921 ERX1298407 ERR1226195 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 19.0 1.5 0.1 4.9 1.6 21.1
LL034F LL034 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040071 SAMEA3732922 ERX1298408 ERR1226196 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 22.0 1.3 0.1 4.8 1.4 21.8
LL035F LL035 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040072 SAMEA3732923 ERX1298409 ERR1226197 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 20.0 1.3 0.1 4.8 1.4 21.8
LL036F LL036 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040073 SAMEA3732924 ERX1298410 ERR1226198 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 24.0 1.3 0.1 4.8 1.4 21.8
LL037F LL037 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040074 SAMEA3732925 ERX1298411 ERR1226199 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 60.0 31.3 1.0 4.7 1.4 31.9
LL038F LL038 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040075 SAMEA3732926 ERX1298412 ERR1226200 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 47.0 31.3 1.0 4.7 1.4 31.9
LL039F LL039 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040076 SAMEA3732927 ERX1298413 ERR1226201 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 66.0 31.3 1.0 4.7 1.4 31.9
LL040F LL040 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040077 SAMEA3732928 ERX1298414 ERR1226202 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 22.0 1.9 0.1 5.0 1.4 20.6
LL041F LL041 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040078 SAMEA3732929 ERX1298415 ERR1226203 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 20.0 1.2 0.1 5.0 1.4 16.7
LL042F LL042 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040079 SAMEA3732930 ERX1298416 ERR1226204 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 19.0 1.4 0.1 5.0 1.4 17.5
LL043F LL043 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040080 SAMEA3732931 ERX1298417 ERR1226205 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 42.0 30.2 0.8 4.4 1.5 36.8
LL044F LL044 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040081 SAMEA3732932 ERX1298418 ERR1226206 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 59.0 30.2 0.8 4.4 1.5 36.8
LL045F LL045 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040082 SAMEA3732933 ERX1298419 ERR1226207 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 46.0 30.2 0.8 4.4 1.5 36.8
LL046F LL046 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040083 SAMEA3732934 ERX1298420 ERR1226208 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 22.0 1.6 0.1 5.0 1.5 21.0
LL047F LL047 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040084 SAMEA3732935 ERX1298421 ERR1226209 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 21.0 1.6 0.1 5.0 1.5 21.0
LL048F LL048 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040085 SAMEA3732936 ERX1298422 ERR1226210 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 23.0 1.6 0.1 5.0 1.5 21.0
LL052F LL052 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040086 SAMEA3732937 ERX1298423 ERR1226211 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 18.0 1.4 0.1 5.1 1.5 22.8
LL053F LL053 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040087 SAMEA3732938 ERX1298424 ERR1226212 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 21.0 1.4 0.1 5.1 1.5 22.8
LL054F LL054 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040088 SAMEA3732939 ERX1298425 ERR1226213 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 21.0 1.4 0.1 5.1 1.5 22.8
LL055F LL055 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040089 SAMEA3732940 ERX1298426 ERR1226214 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 O horizon 56.0 37.8 1.0 4.4 NA 36.4
LL056F LL056 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040090 SAMEA3732941 ERX1298427 ERR1226215 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 O horizon 59.0 37.8 1.0 4.4 NA 36.4
LL057F LL057 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040091 SAMEA3732942 ERX1298428 ERR1226216 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 O horizon 56.0 37.8 1.0 4.4 NA 36.4
LL058F LL058 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040092 SAMEA3732943 ERX1298429 ERR1226217 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 A horizon 19.0 1.6 0.1 4.9 NA 22.3
LL059F LL059 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040093 SAMEA3732944 ERX1298430 ERR1226218 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 A horizon 20.0 1.6 0.1 4.9 NA 22.3
LL060F LL060 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040094 SAMEA3732945 ERX1298431 ERR1226219 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 A horizon 22.0 1.6 0.1 4.9 NA 22.3
OC304F OL304 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040095 SAMEA3732946 ERX1298432 ERR1226220 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 23.5 NA NA 0.0 NA NA
OC305F OL305 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040096 SAMEA3732947 ERX1298433 ERR1226221 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 17.3 NA NA 0.0 NA NA
OC306F OL306 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040097 SAMEA3732948 ERX1298434 ERR1226222 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 22.0 NA NA 0.0 NA NA
OC307F OL307 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040098 SAMEA3732949 ERX1298435 ERR1226223 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 59.5 NA NA 0.0 NA NA
OC308F OL308 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040099 SAMEA3732950 ERX1298436 ERR1226224 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 64.7 NA NA 0.0 NA NA
OC309F OL309 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040100 SAMEA3732951 ERX1298437 ERR1226225 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 61.8 NA NA 0.0 NA NA
OC310F OL310 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040101 SAMEA3732952 ERX1298438 ERR1226226 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.0 NA NA 0.0 NA NA
OC311F OL311 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040102 SAMEA3732953 ERX1298439 ERR1226227 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.6 NA NA 0.0 NA NA
OC312F OL312 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040103 SAMEA3732954 ERX1298440 ERR1226228 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 28.2 NA NA 0.0 NA NA
OC313F OL313 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040104 SAMEA3732955 ERX1298441 ERR1226229 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 O horizon 58.0 NA NA 0.0 NA NA
OC314F OL314 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040105 SAMEA3732956 ERX1298442 ERR1226230 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 O horizon 63.5 NA NA 0.0 NA NA
OC315F OL315 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040106 SAMEA3732957 ERX1298443 ERR1226231 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 O horizon 57.2 NA NA 0.0 NA NA
OC316F OL316 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040107 SAMEA3732958 ERX1298444 ERR1226232 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 A horizon 24.3 NA NA 0.0 NA NA
OC317F OL317 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040108 SAMEA3732959 ERX1298445 ERR1226233 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 A horizon 28.6 NA NA 0.0 NA NA
OC318F OL318 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040109 SAMEA3732960 ERX1298446 ERR1226234 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 A horizon 21.1 NA NA 0.0 NA NA
OC319F OL319 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040110 SAMEA3732961 ERX1298447 ERR1226235 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 O horizon 61.5 NA NA 0.0 NA NA
OC320F OL320 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040111 SAMEA3732962 ERX1298448 ERR1226236 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 O horizon 62.7 NA NA 0.0 NA NA
OC321F OL321 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040112 SAMEA3732963 ERX1298449 ERR1226237 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 O horizon 57.7 NA NA 0.0 NA NA
OC322F OL322 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040113 SAMEA3732964 ERX1298450 ERR1226238 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 A horizon 27.7 NA NA 0.0 NA NA
OC323F OL323 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040114 SAMEA3732965 ERX1298451 ERR1226239 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 A horizon 23.4 NA NA 0.0 NA NA
OC324F OL324 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040115 SAMEA3732966 ERX1298452 ERR1226240 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 A horizon 23.7 NA NA 0.0 NA NA
OC325F OL325 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040116 SAMEA3732967 ERX1298453 ERR1226241 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 64.4 NA NA 0.0 NA NA
OC326F OL326 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040117 SAMEA3732968 ERX1298454 ERR1226242 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 62.2 NA NA 0.0 NA NA
OC327F OL327 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040118 SAMEA3732969 ERX1298455 ERR1226243 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 53.7 NA NA 0.0 NA NA
OC328F OL328 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040119 SAMEA3732970 ERX1298456 ERR1226244 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 26.1 NA NA 0.0 NA NA
OC329F OL329 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040120 SAMEA3732971 ERX1298457 ERR1226245 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 22.3 NA NA 0.0 NA NA
OC330F OL330 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040121 SAMEA3732972 ERX1298458 ERR1226246 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 23.9 NA NA 0.0 NA NA
OC331F OL331 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040122 SAMEA3732973 ERX1298459 ERR1226247 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 O horizon 57.4 NA NA 0.0 NA NA
OC332F OL332 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040123 SAMEA3732974 ERX1298460 ERR1226248 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 O horizon 50.5 NA NA 0.0 NA NA
OC333F OL333 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040124 SAMEA3732975 ERX1298461 ERR1226249 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 O horizon 60.9 NA NA 0.0 NA NA
OC334F OL334 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040125 SAMEA3732976 ERX1298462 ERR1226250 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 A horizon 24.0 NA NA 0.0 NA NA
OC335F OL335 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040126 SAMEA3732977 ERX1298463 ERR1226251 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 A horizon 25.6 NA NA 0.0 NA NA
OC336F OL336 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040127 SAMEA3732978 ERX1298464 ERR1226252 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 A horizon 25.4 NA NA 0.0 NA NA
OC340F OL340 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040128 SAMEA3732979 ERX1298465 ERR1226253 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C2 0 A horizon 22.9 NA NA 0.0 NA NA
OC341F OL341 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040129 SAMEA3732980 ERX1298466 ERR1226254 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C2 0 A horizon 22.1 NA NA 0.0 NA NA
OC342F OL342 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040130 SAMEA3732981 ERX1298467 ERR1226255 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C2 0 A horizon 20.3 NA NA 0.0 NA NA
OC343F OL343 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040131 SAMEA3732982 ERX1298468 ERR1226256 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 O horizon 54.7 NA NA 0.0 NA NA
OC344F OL344 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040132 SAMEA3732983 ERX1298469 ERR1226257 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 O horizon 58.7 NA NA 0.0 NA NA
OC345F OL345 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040133 SAMEA3732984 ERX1298470 ERR1226258 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 O horizon 57.4 NA NA 0.0 NA NA
OC346F OL346 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040134 SAMEA3732985 ERX1298471 ERR1226259 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 A horizon 26.2 NA NA 0.0 NA NA
OC347F OL347 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040135 SAMEA3732986 ERX1298472 ERR1226260 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 A horizon 28.0 NA NA 0.0 NA NA
OC348F OL348 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040136 SAMEA3732987 ERX1298473 ERR1226261 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 A horizon 26.5 NA NA 0.0 NA NA
OC352F OL352 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040137 SAMEA3732988 ERX1298474 ERR1226262 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C1 0 A horizon 23.9 NA NA 0.0 NA NA
OC353F OL353 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040138 SAMEA3732989 ERX1298475 ERR1226263 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C1 0 A horizon 18.4 NA NA 0.0 NA NA
OC354F OL354 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040139 SAMEA3732990 ERX1298476 ERR1226264 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C1 0 A horizon 18.9 NA NA 0.0 NA NA
OC355F OL355 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040140 SAMEA3732991 ERX1298477 ERR1226265 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 56.5 NA NA 0.0 NA NA
OC356F OL356 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040141 SAMEA3732992 ERX1298478 ERR1226266 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 62.0 NA NA 0.0 NA NA
OC357F OL357 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040142 SAMEA3732993 ERX1298479 ERR1226267 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 62.1 NA NA 0.0 NA NA
OC358F OL358 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040143 SAMEA3732994 ERX1298480 ERR1226268 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 23.0 NA NA 0.0 NA NA
OC359F OL359 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040144 SAMEA3732995 ERX1298481 ERR1226269 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 20.6 NA NA 0.0 NA NA
OC360F OL360 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040145 SAMEA3732996 ERX1298482 ERR1226270 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 20.8 NA NA 0.0 NA NA
SL121F SL121 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040146 SAMEA3732997 ERX1298483 ERR1226271 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 63.0 20.7 0.6 5.2 1.6 35.0
SL122F SL122 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040147 SAMEA3732998 ERX1298484 ERR1226272 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 57.0 20.7 0.6 5.2 1.6 35.0
SL123F SL123 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040148 SAMEA3732999 ERX1298485 ERR1226273 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 61.0 20.7 0.6 5.2 1.6 35.0
SL124F SL124 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040149 SAMEA3733000 ERX1298486 ERR1226274 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 30.0 0.9 0.1 5.4 1.6 18.4
SL125F SL125 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040150 SAMEA3733001 ERX1298487 ERR1226275 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 30.0 0.9 0.1 5.4 1.6 18.4
SL126F SL126 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040151 SAMEA3733002 ERX1298488 ERR1226276 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 30.0 0.9 0.1 5.4 1.6 18.4
SL127F SL127 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040152 SAMEA3733003 ERX1298489 ERR1226277 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 60.0 22.3 0.6 5.1 1.6 38.4
SL128F SL128 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040153 SAMEA3733004 ERX1298490 ERR1226278 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 59.0 22.3 0.6 5.1 1.6 38.4
SL129F SL129 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040154 SAMEA3733005 ERX1298491 ERR1226279 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 62.0 22.3 0.6 5.1 1.6 38.4
SL130F SL130 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040155 SAMEA3733006 ERX1298492 ERR1226280 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 32.0 1.0 0.1 5.5 1.6 19.4
SL131F SL131 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040156 SAMEA3733007 ERX1298493 ERR1226281 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 32.0 1.0 0.1 5.5 1.6 19.4
SL132F SL132 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040157 SAMEA3733008 ERX1298494 ERR1226282 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 36.0 1.0 0.1 5.5 1.6 19.4
SL133F SL133 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040158 SAMEA3733009 ERX1298495 ERR1226283 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 50.0 18.8 0.5 5.3 1.8 36.2
SL134F SL134 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040159 SAMEA3733010 ERX1298496 ERR1226284 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 68.0 18.8 0.5 5.3 1.8 36.2
SL135F SL135 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040160 SAMEA3733011 ERX1298497 ERR1226285 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 67.0 18.8 0.5 5.3 1.8 36.2
SL136F SL136 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040161 SAMEA3733012 ERX1298498 ERR1226286 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 31.0 0.8 0.1 5.6 1.8 16.2
SL137F SL137 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040162 SAMEA3733013 ERX1298499 ERR1226287 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 33.0 0.8 0.1 5.6 1.8 16.2
SL138F SL138 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040163 SAMEA3733014 ERX1298500 ERR1226288 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 32.0 0.8 0.1 5.6 1.8 16.2
SL139F SL139 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040164 SAMEA3733015 ERX1298501 ERR1226289 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 56.0 17.5 0.5 5.2 1.7 34.3
SL140F SL140 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040165 SAMEA3733016 ERX1298502 ERR1226290 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 57.0 17.5 0.5 5.2 1.7 34.3
SL141F SL141 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040166 SAMEA3733017 ERX1298503 ERR1226291 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 58.0 17.5 0.5 5.2 1.7 34.3
SL142F SL142 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040167 SAMEA3733018 ERX1298504 ERR1226292 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 33.0 0.9 0.1 5.5 1.7 18.2
SL143F SL143 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040168 SAMEA3733019 ERX1298505 ERR1226293 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 35.0 0.9 0.1 5.5 1.7 18.2
SL144F SL144 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040169 SAMEA3733020 ERX1298506 ERR1226294 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 28.0 0.9 0.1 5.5 1.7 18.2
SL145F SL145 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040170 SAMEA3733021 ERX1298507 ERR1226295 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 55.0 19.9 0.5 5.4 1.7 39.0
SL146F SL146 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040171 SAMEA3733022 ERX1298508 ERR1226296 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 54.0 19.9 0.5 5.4 1.7 39.0
SL147F SL147 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040172 SAMEA3733023 ERX1298509 ERR1226297 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 62.0 19.9 0.5 5.4 1.7 39.0
SL148F SL148 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040173 SAMEA3733024 ERX1298510 ERR1226298 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 33.0 1.4 0.1 5.6 1.7 19.6
SL149F SL149 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040174 SAMEA3733025 ERX1298511 ERR1226299 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 32.0 1.4 0.1 5.6 1.7 19.6
SL150F SL150 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040175 SAMEA3733026 ERX1298512 ERR1226300 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 31.0 1.4 0.1 5.6 1.7 19.6
SL151F SL151 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040176 SAMEA3733027 ERX1298513 ERR1226301 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 51.0 17.9 0.5 5.2 1.7 33.2
SL152F SL152 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040177 SAMEA3733028 ERX1298514 ERR1226302 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 54.0 17.9 0.5 5.2 1.7 33.2
SL153F SL153 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040178 SAMEA3733029 ERX1298515 ERR1226303 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 63.0 17.9 0.5 5.2 1.7 33.2
SL154F SL154 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040179 SAMEA3733030 ERX1298516 ERR1226304 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 28.0 1.1 0.1 5.5 1.7 17.8
SL155F SL155 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040180 SAMEA3733031 ERX1298517 ERR1226305 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 34.0 1.1 0.1 5.5 1.7 17.8
SL156F SL156 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040181 SAMEA3733032 ERX1298518 ERR1226306 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 32.0 1.1 0.1 5.5 1.7 17.8
SL160F SL160 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040182 SAMEA3733033 ERX1298519 ERR1226307 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 33.0 0.9 0.1 5.6 1.7 18.2
SL162F SL162 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040184 SAMEA3733035 ERX1298521 ERR1226309 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 33.0 0.9 0.1 5.6 1.7 18.2
SL166F SL166 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040185 SAMEA3733036 ERX1298522 ERR1226310 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 32.0 1.1 0.1 5.5 1.7 18.2
SL167F SL167 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040186 SAMEA3733037 ERX1298523 ERR1226311 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 32.0 1.1 0.1 5.5 1.7 18.2
SL168F SL168 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040187 SAMEA3733038 ERX1298524 ERR1226312 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 31.0 1.1 0.1 5.5 1.7 18.2
SL172F SL172 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040188 SAMEA3733039 ERX1298525 ERR1226313 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 32.0 0.9 0.1 5.7 1.7 18.0
SL173F SL173 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040189 SAMEA3733040 ERX1298526 ERR1226314 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 30.0 0.9 0.1 5.7 1.7 18.0
SL174F SL174 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040190 SAMEA3733041 ERX1298527 ERR1226315 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 32.0 0.9 0.1 5.7 1.7 18.0
SL175F SL175 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040191 SAMEA3733042 ERX1298528 ERR1226316 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 85.0 18.9 0.6 5.4 NA 33.7
SL176F SL176 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040192 SAMEA3733043 ERX1298529 ERR1226317 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 73.0 18.9 0.6 5.4 NA 33.7
SL177F SL177 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040193 SAMEA3733044 ERX1298530 ERR1226318 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 71.0 18.9 0.6 5.4 NA 33.7
SL178F SL178 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040194 SAMEA3733045 ERX1298531 ERR1226319 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 36.0 0.9 0.1 5.8 NA 17.4
SL179F SL179 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040195 SAMEA3733046 ERX1298532 ERR1226320 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 36.0 0.9 0.1 5.8 NA 17.4
SL180F SL180 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040196 SAMEA3733047 ERX1298533 ERR1226321 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 34.0 0.9 0.1 5.8 NA 17.4
TO061F TO061 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040197 SAMEA3733048 ERX1298534 ERR1226322 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 58.0 33.5 1.0 5.1 1.5 32.5
TO062F TO062 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040198 SAMEA3733049 ERX1298535 ERR1226323 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 52.0 33.5 1.0 5.1 1.5 32.5
TO063F TO063 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040199 SAMEA3733050 ERX1298536 ERR1226324 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 56.0 33.5 1.0 5.1 1.5 32.5
TO064F TO064 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040200 SAMEA3733051 ERX1298537 ERR1226325 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 20.0 2.2 0.1 5.7 1.5 21.6
TO065F TO065 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040201 SAMEA3733052 ERX1298538 ERR1226326 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 17.0 2.2 0.1 5.7 1.5 21.6
TO066F TO066 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040202 SAMEA3733053 ERX1298539 ERR1226327 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 15.0 2.2 0.1 5.7 1.5 21.6
TO067F TO067 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040203 SAMEA3733054 ERX1298540 ERR1226328 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 58.0 26.4 0.9 4.8 1.5 28.7
TO068F TO068 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040204 SAMEA3733055 ERX1298541 ERR1226329 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 47.0 26.4 0.9 4.8 1.5 28.7
TO069F TO069 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040205 SAMEA3733056 ERX1298542 ERR1226330 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 43.0 26.4 0.9 4.8 1.5 28.7
TO070F TO070 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040206 SAMEA3733057 ERX1298543 ERR1226331 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 25.0 3.3 0.2 5.0 1.5 20.3
TO071F TO071 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040207 SAMEA3733058 ERX1298544 ERR1226332 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 19.0 3.3 0.2 5.0 1.5 20.3
TO072F TO072 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040208 SAMEA3733059 ERX1298545 ERR1226333 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 27.0 3.3 0.2 5.0 1.5 20.3
TO076F TO076 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040209 SAMEA3733060 ERX1298546 ERR1226334 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 20.0 2.2 0.1 5.0 1.6 24.3
TO077F TO077 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040210 SAMEA3733061 ERX1298547 ERR1226335 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 19.0 2.2 0.1 5.0 1.6 24.3
TO078F TO078 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040211 SAMEA3733062 ERX1298548 ERR1226336 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 18.0 2.2 0.1 5.0 1.6 24.3
TO079F TO079 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040212 SAMEA3733063 ERX1298549 ERR1226337 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 52.0 27.6 0.8 4.7 1.8 34.9
TO080F TO080 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040213 SAMEA3733064 ERX1298550 ERR1226338 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 66.0 27.6 0.8 4.7 1.8 34.9
TO081F TO081 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040214 SAMEA3733065 ERX1298551 ERR1226339 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 69.0 27.6 0.8 4.7 1.8 34.9
TO082F TO082 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040215 SAMEA3733066 ERX1298552 ERR1226340 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 30.0 1.9 0.1 4.9 1.8 21.1
TO083F TO083 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040216 SAMEA3733067 ERX1298553 ERR1226341 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 25.0 1.9 0.1 4.9 1.8 21.1
TO084F TO084 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040217 SAMEA3733068 ERX1298554 ERR1226342 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 25.0 1.9 0.1 4.9 1.8 21.1
TO085F TO085 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040218 SAMEA3733069 ERX1298555 ERR1226343 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 68.0 37.1 1.2 4.9 1.7 32.0
TO086F TO086 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040219 SAMEA3733070 ERX1298556 ERR1226344 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 68.0 37.1 1.2 4.9 1.7 32.0
TO087F TO087 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040220 SAMEA3733071 ERX1298557 ERR1226345 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 56.0 37.1 1.2 4.9 1.7 32.0
TO088F TO088 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040221 SAMEA3733072 ERX1298558 ERR1226346 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 18.0 1.9 0.1 4.9 1.7 21.6
TO089F TO089 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040222 SAMEA3733073 ERX1298559 ERR1226347 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 22.0 1.9 0.1 4.9 1.7 21.6
TO090F TO090 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040223 SAMEA3733074 ERX1298560 ERR1226348 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 20.0 1.9 0.1 4.9 1.7 21.6
TO094F TO094 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040224 SAMEA3733075 ERX1298561 ERR1226349 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 16.0 1.7 0.1 5.5 1.7 21.0
TO095F TO095 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040225 SAMEA3733076 ERX1298562 ERR1226350 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 17.0 1.7 0.1 5.5 1.7 21.0
TO096F TO096 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040226 SAMEA3733077 ERX1298563 ERR1226351 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 15.0 1.7 0.1 5.5 1.7 21.0
TO097F TO097 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040227 SAMEA3733078 ERX1298564 ERR1226352 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 60.0 35.6 0.9 5.1 1.5 37.9
TO098F TO098 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040228 SAMEA3733079 ERX1298565 ERR1226353 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 64.0 35.6 0.9 5.1 1.5 37.9
TO099F TO099 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040229 SAMEA3733080 ERX1298566 ERR1226354 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 66.0 35.6 0.9 5.1 1.5 37.9
TO100F TO100 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040230 SAMEA3733081 ERX1298567 ERR1226355 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 21.0 2.3 0.1 5.2 1.5 20.7
TO101F TO101 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040231 SAMEA3733082 ERX1298568 ERR1226356 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 22.0 2.3 0.1 5.2 1.5 20.7
TO102F TO102 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040232 SAMEA3733083 ERX1298569 ERR1226357 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 17.0 2.3 0.1 5.2 1.5 20.7
TO103F TO103 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040233 SAMEA3733084 ERX1298570 ERR1226358 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 86.0 30.6 0.9 5.1 1.8 34.8
TO104F TO104 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040234 SAMEA3733085 ERX1298571 ERR1226359 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 74.0 30.6 0.9 5.1 1.8 34.8
TO105F TO105 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040235 SAMEA3733086 ERX1298572 ERR1226360 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 64.0 30.6 0.9 5.1 1.8 34.8
TO106F TO106 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040236 SAMEA3733087 ERX1298573 ERR1226361 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 18.0 3.1 0.2 5.1 1.8 19.6
TO107F TO107 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040237 SAMEA3733088 ERX1298574 ERR1226362 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 27.0 3.1 0.2 5.1 1.8 19.6
TO108F TO108 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040238 SAMEA3733089 ERX1298575 ERR1226363 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 18.0 3.1 0.2 5.1 1.8 19.6
TO112F TO112 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040239 SAMEA3733090 ERX1298576 ERR1226364 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 20.0 1.8 0.1 5.7 1.6 19.5
TO113F TO113 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040240 SAMEA3733091 ERX1298577 ERR1226365 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 16.0 1.8 0.1 5.7 1.6 19.5
TO114F TO114 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040241 SAMEA3733092 ERX1298578 ERR1226366 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 18.0 1.8 0.1 5.7 1.6 19.5
TO115F TO115 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040242 SAMEA3733093 ERX1298579 ERR1226367 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 79.0 44.8 1.1 4.4 NA 42.3
TO116F TO116 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040243 SAMEA3733094 ERX1298580 ERR1226368 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 76.0 44.8 1.1 4.4 NA 42.3
TO117F TO117 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040244 SAMEA3733095 ERX1298581 ERR1226369 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 72.0 44.8 1.1 4.4 NA 42.3
TO118F TO118 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040245 SAMEA3733096 ERX1298582 ERR1226370 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 20.0 1.1 0.1 5.0 NA 22.2
TO119F TO119 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040246 SAMEA3733097 ERX1298583 ERR1226371 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 19.0 1.1 0.1 5.0 NA 22.2
TO120F TO120 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040247 SAMEA3733098 ERX1298584 ERR1226372 ITS ITS2 NA TCCTCCGCTTATTGATATGC GCATCGATGAAGAACGCAGC 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 25.0 1.1 0.1 5.0 NA 22.2
BP241B BP241 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040248 SAMEA3733099 ERX1298585 ERR1226373 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 88.0 2.5 0.1 5.5 1.4 22.8
BP242B BP242 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040249 SAMEA3733100 ERX1298586 ERR1226374 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 90.0 2.5 0.1 5.5 1.4 22.8
BP243B BP243 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040250 SAMEA3733101 ERX1298587 ERR1226375 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 93.0 2.5 0.1 5.5 1.4 22.8
BP244B BP244 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040251 SAMEA3733102 ERX1298588 ERR1226376 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 40.0 41.8 1.5 5.8 1.4 27.7
BP245B BP245 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040252 SAMEA3733103 ERX1298589 ERR1226377 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 50.0 41.8 1.5 5.8 1.4 27.7
BP246B BP246 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040253 SAMEA3733104 ERX1298590 ERR1226378 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 39.0 41.8 1.5 5.8 1.4 27.7
BP250B BP250 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040254 SAMEA3733105 ERX1298591 ERR1226379 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 53.0 2.0 0.1 5.6 1.5 22.3
BP251B BP251 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040255 SAMEA3733106 ERX1298592 ERR1226380 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 50.0 2.0 0.1 5.6 1.5 22.3
BP252B BP252 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040256 SAMEA3733107 ERX1298593 ERR1226381 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 38.0 2.0 0.1 5.6 1.5 22.3
BP256B BP256 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040257 SAMEA3733108 ERX1298594 ERR1226382 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 45.0 2.6 0.1 5.7 1.5 23.6
BP257B BP257 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040258 SAMEA3733109 ERX1298595 ERR1226383 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 55.0 2.6 0.1 5.7 1.5 23.6
BP258B BP258 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040259 SAMEA3733110 ERX1298596 ERR1226384 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 46.0 2.6 0.1 5.7 1.5 23.6
BP259B BP259 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040260 SAMEA3733111 ERX1298597 ERR1226385 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 88.0 38.7 1.1 5.6 1.0 35.2
BP260B BP260 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040261 SAMEA3733112 ERX1298598 ERR1226386 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 88.0 38.7 1.1 5.6 1.0 35.2
BP261B BP261 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040262 SAMEA3733113 ERX1298599 ERR1226387 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 83.0 38.7 1.1 5.6 1.0 35.2
BP262B BP262 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040263 SAMEA3733114 ERX1298600 ERR1226388 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 43.0 3.0 0.1 5.4 1.0 27.1
BP263B BP263 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040264 SAMEA3733115 ERX1298601 ERR1226389 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 48.0 3.0 0.1 5.4 1.0 27.1
BP264B BP264 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040265 SAMEA3733116 ERX1298602 ERR1226390 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 47.0 3.0 0.1 5.4 1.0 27.1
BP265B BP265 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040266 SAMEA3733117 ERX1298603 ERR1226391 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 79.0 43.2 0.9 5.1 1.1 50.9
BP266B BP266 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040267 SAMEA3733118 ERX1298604 ERR1226392 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 83.0 43.2 0.9 5.1 1.1 50.9
BP267B BP267 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040268 SAMEA3733119 ERX1298605 ERR1226393 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 79.0 43.2 0.9 5.1 1.1 50.9
BP268B BP268 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040269 SAMEA3733120 ERX1298606 ERR1226394 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 44.0 2.8 0.1 5.4 1.1 27.6
BP269B BP269 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040270 SAMEA3733121 ERX1298607 ERR1226395 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 47.0 2.8 0.1 5.4 1.1 27.6
BP270B BP270 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040271 SAMEA3733122 ERX1298608 ERR1226396 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 51.0 2.8 0.1 5.4 1.1 27.6
BP271B BP271 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040272 SAMEA3733123 ERX1298609 ERR1226397 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 89.0 38.6 1.0 5.3 1.3 37.5
BP272B BP272 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040273 SAMEA3733124 ERX1298610 ERR1226398 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 83.0 38.6 1.0 5.3 1.3 37.5
BP273B BP273 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040274 SAMEA3733125 ERX1298611 ERR1226399 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 88.0 38.6 1.0 5.3 1.3 37.5
BP274B BP274 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040275 SAMEA3733126 ERX1298612 ERR1226400 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 43.0 2.7 0.1 5.5 1.3 24.2
BP275B BP275 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040276 SAMEA3733127 ERX1298613 ERR1226401 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 50.0 2.7 0.1 5.5 1.3 24.2
BP276B BP276 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040277 SAMEA3733128 ERX1298614 ERR1226402 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 44.0 2.7 0.1 5.5 1.3 24.2
BP277B BP277 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040278 SAMEA3733129 ERX1298615 ERR1226403 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 87.0 33.4 0.9 5.2 1.2 38.4
BP278B BP278 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040279 SAMEA3733130 ERX1298616 ERR1226404 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 86.0 33.4 0.9 5.2 1.2 38.4
BP279B BP279 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040280 SAMEA3733131 ERX1298617 ERR1226405 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 75.0 33.4 0.9 5.2 1.2 38.4
BP280B BP280 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040281 SAMEA3733132 ERX1298618 ERR1226406 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 53.0 2.1 0.1 5.3 1.2 22.9
BP281B BP281 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040282 SAMEA3733133 ERX1298619 ERR1226407 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 51.0 2.1 0.1 5.3 1.2 22.9
BP282B BP282 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040283 SAMEA3733134 ERX1298620 ERR1226408 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 45.0 2.1 0.1 5.3 1.2 22.9
BP286B BP286 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040284 SAMEA3733135 ERX1298621 ERR1226409 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 42.0 2.1 0.1 5.7 1.3 23.3
BP287B BP287 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040285 SAMEA3733136 ERX1298622 ERR1226410 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 48.0 2.1 0.1 5.7 1.3 23.3
BP288B BP288 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040286 SAMEA3733137 ERX1298623 ERR1226411 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 47.0 2.1 0.1 5.7 1.3 23.3
BP289B BP289 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040287 SAMEA3733138 ERX1298624 ERR1226412 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 80.0 37.6 0.9 5.1 1.4 41.4
BP290B BP290 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040288 SAMEA3733139 ERX1298625 ERR1226413 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 87.0 37.6 0.9 5.1 1.4 41.4
BP291B BP291 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040289 SAMEA3733140 ERX1298626 ERR1226414 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 80.0 37.6 0.9 5.1 1.4 41.4
BP292B BP292 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040290 SAMEA3733141 ERX1298627 ERR1226415 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 47.0 3.6 0.2 5.7 1.4 23.7
BP293B BP293 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040291 SAMEA3733142 ERX1298628 ERR1226416 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 49.0 3.6 0.2 5.7 1.4 23.7
BP294B BP294 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040292 SAMEA3733143 ERX1298629 ERR1226417 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 42.0 3.6 0.2 5.7 1.4 23.7
BP295B BP295 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040293 SAMEA3733144 ERX1298630 ERR1226418 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 74.0 44.4 1.3 5.4 NA 35.5
BP296B BP296 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040294 SAMEA3733145 ERX1298631 ERR1226419 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 88.0 44.4 1.3 5.4 NA 35.5
BP297B BP297 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040295 SAMEA3733146 ERX1298632 ERR1226420 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 84.0 44.4 1.3 5.4 NA 35.5
BP298B BP298 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040296 SAMEA3733147 ERX1298633 ERR1226421 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 46.0 2.4 0.1 5.6 NA 24.2
BP299B BP299 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040297 SAMEA3733148 ERX1298634 ERR1226422 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 44.0 2.4 0.1 5.6 NA 24.2
BP300B BP300 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040298 SAMEA3733149 ERX1298635 ERR1226423 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-22 50.93 -120.28 Canada 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 45.0 2.4 0.1 5.6 NA 24.2
DC184B DC184 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040299 SAMEA3733150 ERX1298636 ERR1226424 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 20.0 1.7 0.1 5.9 1.5 18.4
DC185B DC185 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040300 SAMEA3733151 ERX1298637 ERR1226425 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 26.0 1.7 0.1 5.9 1.5 18.4
DC186B DC186 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040301 SAMEA3733152 ERX1298638 ERR1226426 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C0 0 A horizon 20.0 1.7 0.1 5.9 1.5 18.4
DC187B DC187 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040302 SAMEA3733153 ERX1298639 ERR1226427 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 58.0 32.9 1.3 6.0 1.3 25.1
DC188B DC188 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040303 SAMEA3733154 ERX1298640 ERR1226428 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 63.0 32.9 1.3 6.0 1.3 25.1
DC189B DC189 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040304 SAMEA3733155 ERX1298641 ERR1226429 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 O horizon 56.0 32.9 1.3 6.0 1.3 25.1
DC190B DC190 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040305 SAMEA3733156 ERX1298642 ERR1226430 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 21.0 3.3 0.2 5.6 1.3 20.5
DC191B DC191 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040306 SAMEA3733157 ERX1298643 ERR1226431 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 23.0 3.3 0.2 5.6 1.3 20.5
DC192B DC192 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040307 SAMEA3733158 ERX1298644 ERR1226432 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C0 0 A horizon 25.0 3.3 0.2 5.6 1.3 20.5
DC193B DC193 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040308 SAMEA3733159 ERX1298645 ERR1226433 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 61.0 32.9 1.2 5.8 1.5 28.4
DC194B DC194 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040309 SAMEA3733160 ERX1298646 ERR1226434 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 63.0 32.9 1.2 5.8 1.5 28.4
DC195B DC195 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040310 SAMEA3733161 ERX1298647 ERR1226435 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 O horizon 57.0 32.9 1.2 5.8 1.5 28.4
DC196B DC196 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040311 SAMEA3733162 ERX1298648 ERR1226436 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 29.0 2.1 0.1 5.6 1.5 20.5
DC197B DC197 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040312 SAMEA3733163 ERX1298649 ERR1226437 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 27.0 2.1 0.1 5.6 1.5 20.5
DC198B DC198 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040313 SAMEA3733164 ERX1298650 ERR1226438 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C1 0 A horizon 21.0 2.1 0.1 5.6 1.5 20.5
DC199B DC199 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040314 SAMEA3733165 ERX1298651 ERR1226439 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 58.0 30.1 1.0 5.8 1.5 29.3
DC200B DC200 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040315 SAMEA3733166 ERX1298652 ERR1226440 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 53.0 30.1 1.0 5.8 1.5 29.3
DC201B DC201 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040316 SAMEA3733167 ERX1298653 ERR1226441 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 O horizon 59.0 30.1 1.0 5.8 1.5 29.3
DC202B DC202 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040317 SAMEA3733168 ERX1298654 ERR1226442 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 24.0 2.4 0.1 5.8 1.5 18.5
DC203B DC203 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040318 SAMEA3733169 ERX1298655 ERR1226443 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 33.0 2.4 0.1 5.8 1.5 18.5
DC204B DC204 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040319 SAMEA3733170 ERX1298656 ERR1226444 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM2 C2 0 A horizon 30.0 2.4 0.1 5.8 1.5 18.5
DC205B DC205 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040320 SAMEA3733171 ERX1298657 ERR1226445 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 60.0 38.7 1.3 5.6 1.4 29.5
DC206B DC206 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040321 SAMEA3733172 ERX1298658 ERR1226446 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 60.0 38.7 1.3 5.6 1.4 29.5
DC207B DC207 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040322 SAMEA3733173 ERX1298659 ERR1226447 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 O horizon 58.0 38.7 1.3 5.6 1.4 29.5
DC208B DC208 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040323 SAMEA3733174 ERX1298660 ERR1226448 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 28.0 2.3 0.1 5.2 1.4 20.5
DC209B DC209 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040324 SAMEA3733175 ERX1298661 ERR1226449 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.0 2.3 0.1 5.2 1.4 20.5
DC210B DC210 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040325 SAMEA3733176 ERX1298662 ERR1226450 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C0 0 A horizon 24.0 2.3 0.1 5.2 1.4 20.5
DC214B DC214 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040326 SAMEA3733177 ERX1298663 ERR1226451 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 17.0 1.8 0.1 5.7 1.7 19.7
DC215B DC215 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040327 SAMEA3733178 ERX1298664 ERR1226452 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 18.0 1.8 0.1 5.7 1.7 19.7
DC216B DC216 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040328 SAMEA3733179 ERX1298665 ERR1226453 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C1 0 A horizon 25.0 1.8 0.1 5.7 1.7 19.7
DC220B DC220 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040329 SAMEA3733180 ERX1298666 ERR1226454 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 25.0 2.0 0.1 5.8 1.7 18.0
DC222B DC222 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040330 SAMEA3733181 ERX1298667 ERR1226455 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM3 C2 0 A horizon 21.0 2.0 0.1 5.8 1.7 18.0
DC223B DC223 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040331 SAMEA3733182 ERX1298668 ERR1226456 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 63.0 38.8 1.0 5.5 1.5 39.2
DC224B DC224 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040332 SAMEA3733183 ERX1298669 ERR1226457 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 57.0 38.8 1.0 5.5 1.5 39.2
DC225B DC225 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040333 SAMEA3733184 ERX1298670 ERR1226458 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 O horizon 63.0 38.8 1.0 5.5 1.5 39.2
DC226B DC226 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040334 SAMEA3733185 ERX1298671 ERR1226459 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 27.0 2.6 0.1 5.5 1.5 21.4
DC227B DC227 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040335 SAMEA3733186 ERX1298672 ERR1226460 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 26.0 2.6 0.1 5.5 1.5 21.4
DC228B DC228 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040336 SAMEA3733187 ERX1298673 ERR1226461 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C2 0 A horizon 27.0 2.6 0.1 5.5 1.5 21.4
DC229B DC229 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040337 SAMEA3733188 ERX1298674 ERR1226462 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 60.0 36.7 1.1 5.9 1.4 33.3
DC230B DC230 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040338 SAMEA3733189 ERX1298675 ERR1226463 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 60.0 36.7 1.1 5.9 1.4 33.3
DC231B DC231 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040339 SAMEA3733190 ERX1298676 ERR1226464 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 O horizon 52.0 36.7 1.1 5.9 1.4 33.3
DC232B DC232 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040340 SAMEA3733191 ERX1298677 ERR1226465 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 29.0 2.8 0.1 5.9 1.4 19.9
DC233B DC233 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040341 SAMEA3733192 ERX1298678 ERR1226466 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 29.0 2.8 0.1 5.9 1.4 19.9
DC234B DC234 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040342 SAMEA3733193 ERX1298679 ERR1226467 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 C1 0 A horizon 29.0 2.8 0.1 5.9 1.4 19.9
DC235B DC235 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040343 SAMEA3733194 ERX1298680 ERR1226468 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 63.0 44.3 1.1 5.0 NA 41.4
DC236B DC236 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040344 SAMEA3733195 ERX1298681 ERR1226469 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 64.0 44.3 1.1 5.0 NA 41.4
DC237B DC237 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040345 SAMEA3733196 ERX1298682 ERR1226470 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 O horizon 60.0 44.3 1.1 5.0 NA 41.4
DC238B DC238 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040346 SAMEA3733197 ERX1298683 ERR1226471 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 25.0 2.3 0.1 5.2 NA 23.4
DC239B DC239 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040347 SAMEA3733198 ERX1298684 ERR1226472 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 27.0 2.3 0.1 5.2 NA 23.4
DC240B DC240 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040348 SAMEA3733199 ERX1298685 ERR1226473 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-25 50.85 -120.42 Canada 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF REF 0 A horizon 34.0 2.3 0.1 5.2 NA 23.4
LL001B LL001 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040349 SAMEA3733200 ERX1298686 ERR1226474 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 42.0 24.3 0.8 4.7 1.4 30.8
LL002B LL002 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040350 SAMEA3733201 ERX1298687 ERR1226475 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 48.0 24.3 0.8 4.7 1.4 30.8
LL003B LL003 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040351 SAMEA3733202 ERX1298688 ERR1226476 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 40.0 24.3 0.8 4.7 1.4 30.8
LL004B LL004 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040352 SAMEA3733203 ERX1298689 ERR1226477 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 22.0 1.6 0.1 4.7 1.4 22.1
LL005B LL005 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040353 SAMEA3733204 ERX1298690 ERR1226478 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 20.0 1.6 0.1 4.7 1.4 22.1
LL006B LL006 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040354 SAMEA3733205 ERX1298691 ERR1226479 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 21.0 1.6 0.1 4.7 1.4 22.1
LL007B LL007 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040355 SAMEA3733206 ERX1298692 ERR1226480 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 48.0 27.6 0.8 4.5 1.6 33.7
LL008B LL008 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040356 SAMEA3733207 ERX1298693 ERR1226481 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 49.0 27.6 0.8 4.5 1.6 33.7
LL009B LL009 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040357 SAMEA3733208 ERX1298694 ERR1226482 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 40.0 27.6 0.8 4.5 1.6 33.7
LL010B LL010 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040358 SAMEA3733209 ERX1298695 ERR1226483 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 17.0 1.2 0.1 4.8 1.6 19.3
LL011B LL011 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040359 SAMEA3733210 ERX1298696 ERR1226484 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 19.0 1.2 0.1 4.8 1.6 19.3
LL012B LL012 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040360 SAMEA3733211 ERX1298697 ERR1226485 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 16.0 1.2 0.1 4.8 1.6 19.3
LL016B LL016 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040361 SAMEA3733212 ERX1298698 ERR1226486 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 23.0 1.7 0.1 5.1 1.3 20.9
LL017B LL017 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040362 SAMEA3733213 ERX1298699 ERR1226487 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 20.0 1.7 0.1 5.1 1.3 20.9
LL018B LL018 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040363 SAMEA3733214 ERX1298700 ERR1226488 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 21.0 1.7 0.1 5.1 1.3 20.9
LL019B LL019 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040364 SAMEA3733215 ERX1298701 ERR1226489 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 61.0 36.0 0.8 4.6 1.5 43.8
LL020B LL020 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040365 SAMEA3733216 ERX1298702 ERR1226490 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 46.0 36.0 0.8 4.6 1.5 43.8
LL021B LL021 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040366 SAMEA3733217 ERX1298703 ERR1226491 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 44.0 36.0 0.8 4.6 1.5 43.8
LL022B LL022 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040367 SAMEA3733218 ERX1298704 ERR1226492 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 17.0 1.2 0.1 4.6 1.5 23.4
LL023B LL023 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040368 SAMEA3733219 ERX1298705 ERR1226493 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 20.0 1.2 0.1 4.6 1.5 23.4
LL024B LL024 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040369 SAMEA3733220 ERX1298706 ERR1226494 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 19.0 1.2 0.1 4.6 1.5 23.4
LL025B LL025 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040370 SAMEA3733221 ERX1298707 ERR1226495 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 52.0 27.5 0.8 4.5 1.6 34.8
LL026B LL026 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040371 SAMEA3733222 ERX1298708 ERR1226496 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 55.0 27.5 0.8 4.5 1.6 34.8
LL027B LL027 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040372 SAMEA3733223 ERX1298709 ERR1226497 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 60.0 27.5 0.8 4.5 1.6 34.8
LL028B LL028 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040373 SAMEA3733224 ERX1298710 ERR1226498 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 20.0 1.5 0.1 4.9 1.6 21.1
LL029B LL029 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040374 SAMEA3733225 ERX1298711 ERR1226499 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 17.0 1.5 0.1 4.9 1.6 21.1
LL030B LL030 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040375 SAMEA3733226 ERX1298712 ERR1226500 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 19.0 1.5 0.1 4.9 1.6 21.1
LL034B LL034 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040376 SAMEA3733227 ERX1298713 ERR1226501 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 22.0 1.3 0.1 4.8 1.4 21.8
LL035B LL035 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040377 SAMEA3733228 ERX1298714 ERR1226502 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 20.0 1.3 0.1 4.8 1.4 21.8
LL036B LL036 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040378 SAMEA3733229 ERX1298715 ERR1226503 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 24.0 1.3 0.1 4.8 1.4 21.8
LL037B LL037 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040379 SAMEA3733230 ERX1298716 ERR1226504 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 60.0 31.3 1.0 4.7 1.4 31.9
LL038B LL038 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040380 SAMEA3733231 ERX1298717 ERR1226505 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 47.0 31.3 1.0 4.7 1.4 31.9
LL039B LL039 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040381 SAMEA3733232 ERX1298718 ERR1226506 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 66.0 31.3 1.0 4.7 1.4 31.9
LL040B LL040 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040382 SAMEA3733233 ERX1298719 ERR1226507 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 22.0 1.9 0.1 5.0 1.4 20.6
LL041B LL041 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040383 SAMEA3733234 ERX1298720 ERR1226508 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 20.0 1.2 0.1 5.0 1.4 16.7
LL042B LL042 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040384 SAMEA3733235 ERX1298721 ERR1226509 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 19.0 1.4 0.1 5.0 1.4 17.5
LL043B LL043 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040385 SAMEA3733236 ERX1298722 ERR1226510 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 42.0 30.2 0.8 4.4 1.5 36.8
LL044B LL044 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040386 SAMEA3733237 ERX1298723 ERR1226511 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 59.0 30.2 0.8 4.4 1.5 36.8
LL045B LL045 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040387 SAMEA3733238 ERX1298724 ERR1226512 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 46.0 30.2 0.8 4.4 1.5 36.8
LL046B LL046 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040388 SAMEA3733239 ERX1298725 ERR1226513 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 22.0 1.6 0.1 5.0 1.5 21.0
LL047B LL047 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040389 SAMEA3733240 ERX1298726 ERR1226514 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 21.0 1.6 0.1 5.0 1.5 21.0
LL048B LL048 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040390 SAMEA3733241 ERX1298727 ERR1226515 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 23.0 1.6 0.1 5.0 1.5 21.0
LL052B LL052 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040391 SAMEA3733242 ERX1298728 ERR1226516 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 18.0 1.4 0.1 5.1 1.5 22.8
LL053B LL053 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040392 SAMEA3733243 ERX1298729 ERR1226517 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 21.0 1.4 0.1 5.1 1.5 22.8
LL054B LL054 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040393 SAMEA3733244 ERX1298730 ERR1226518 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 21.0 1.4 0.1 5.1 1.5 22.8
LL055B LL055 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040394 SAMEA3733245 ERX1298731 ERR1226519 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 O horizon 56.0 37.8 1.0 4.4 NA 36.4
LL056B LL056 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040395 SAMEA3733246 ERX1298732 ERR1226520 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 O horizon 59.0 37.8 1.0 4.4 NA 36.4
LL057B LL057 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040396 SAMEA3733247 ERX1298733 ERR1226521 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.1 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 O horizon 56.0 37.8 1.0 4.4 NA 36.4
LL058B LL058 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040397 SAMEA3733248 ERX1298734 ERR1226522 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 A horizon 19.0 1.6 0.1 4.9 NA 22.3
LL059B LL059 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040398 SAMEA3733249 ERX1298735 ERR1226523 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 A horizon 20.0 1.6 0.1 4.9 NA 22.3
LL060B LL060 SBSBC British Columbia LL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040399 SAMEA3733250 ERX1298736 ERR1226524 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-09 54.35 -122.61 Canada 0.3 780 3.3 146-193 Orthic Humo-Ferric Podzol, Gleyed Eluviated Dystric Brunisol Subalpine fir, Douglas fir, Interior Spruce Dfc, Boreal cool summer REF REF 0 A horizon 22.0 1.6 0.1 4.9 NA 22.3
OC304B OL304 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040400 SAMEA3733251 ERX1298737 ERR1226525 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 23.5 NA NA 0.0 NA NA
OC305B OL305 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040401 SAMEA3733252 ERX1298738 ERR1226526 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 17.3 NA NA 0.0 NA NA
OC306B OL306 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040402 SAMEA3733253 ERX1298739 ERR1226527 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C0 0 A horizon 22.0 NA NA 0.0 NA NA
OC307B OL307 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040403 SAMEA3733254 ERX1298740 ERR1226528 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 59.5 NA NA 0.0 NA NA
OC308B OL308 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040404 SAMEA3733255 ERX1298741 ERR1226529 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 64.7 NA NA 0.0 NA NA
OC309B OL309 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040405 SAMEA3733256 ERX1298742 ERR1226530 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 O horizon 61.8 NA NA 0.0 NA NA
OC310B OL310 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040406 SAMEA3733257 ERX1298743 ERR1226531 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.0 NA NA 0.0 NA NA
OC311B OL311 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040407 SAMEA3733258 ERX1298744 ERR1226532 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.6 NA NA 0.0 NA NA
OC312B OL312 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040408 SAMEA3733259 ERX1298745 ERR1226533 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C0 0 A horizon 28.2 NA NA 0.0 NA NA
OC313B OL313 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040409 SAMEA3733260 ERX1298746 ERR1226534 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 O horizon 58.0 NA NA 0.0 NA NA
OC314B OL314 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040410 SAMEA3733261 ERX1298747 ERR1226535 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 O horizon 63.5 NA NA 0.0 NA NA
OC315B OL315 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040411 SAMEA3733262 ERX1298748 ERR1226536 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 O horizon 57.2 NA NA 0.0 NA NA
OC316B OL316 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040412 SAMEA3733263 ERX1298749 ERR1226537 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 A horizon 24.3 NA NA 0.0 NA NA
OC317B OL317 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040413 SAMEA3733264 ERX1298750 ERR1226538 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 A horizon 28.6 NA NA 0.0 NA NA
OC318B OL318 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040414 SAMEA3733265 ERX1298751 ERR1226539 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C1 0 A horizon 21.1 NA NA 0.0 NA NA
OC319B OL319 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040415 SAMEA3733266 ERX1298752 ERR1226540 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 O horizon 61.5 NA NA 0.0 NA NA
OC320B OL320 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040416 SAMEA3733267 ERX1298753 ERR1226541 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 O horizon 62.7 NA NA 0.0 NA NA
OC321B OL321 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040417 SAMEA3733268 ERX1298754 ERR1226542 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 O horizon 57.7 NA NA 0.0 NA NA
OC322B OL322 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040418 SAMEA3733269 ERX1298755 ERR1226543 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 A horizon 27.7 NA NA 0.0 NA NA
OC323B OL323 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040419 SAMEA3733270 ERX1298756 ERR1226544 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 A horizon 23.4 NA NA 0.0 NA NA
OC324B OL324 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040420 SAMEA3733271 ERX1298757 ERR1226545 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C2 0 A horizon 23.7 NA NA 0.0 NA NA
OC325B OL325 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040421 SAMEA3733272 ERX1298758 ERR1226546 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 64.4 NA NA 0.0 NA NA
OC326B OL326 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040422 SAMEA3733273 ERX1298759 ERR1226547 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 62.2 NA NA 0.0 NA NA
OC327B OL327 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040423 SAMEA3733274 ERX1298760 ERR1226548 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 O horizon 53.7 NA NA 0.0 NA NA
OC328B OL328 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040424 SAMEA3733275 ERX1298761 ERR1226549 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 26.1 NA NA 0.0 NA NA
OC329B OL329 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040425 SAMEA3733276 ERX1298762 ERR1226550 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 22.3 NA NA 0.0 NA NA
OC330B OL330 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040426 SAMEA3733277 ERX1298763 ERR1226551 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM2 C0 0 A horizon 23.9 NA NA 0.0 NA NA
OC331B OL331 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040427 SAMEA3733278 ERX1298764 ERR1226552 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 O horizon 57.4 NA NA 0.0 NA NA
OC332B OL332 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040428 SAMEA3733279 ERX1298765 ERR1226553 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 O horizon 50.5 NA NA 0.0 NA NA
OC333B OL333 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040429 SAMEA3733280 ERX1298766 ERR1226554 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 O horizon 60.9 NA NA 0.0 NA NA
OC334B OL334 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040430 SAMEA3733281 ERX1298767 ERR1226555 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 A horizon 24.0 NA NA 0.0 NA NA
OC335B OL335 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040431 SAMEA3733282 ERX1298768 ERR1226556 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 A horizon 25.6 NA NA 0.0 NA NA
OC336B OL336 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040432 SAMEA3733283 ERX1298769 ERR1226557 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C2 0 A horizon 25.4 NA NA 0.0 NA NA
OC340B OL340 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040433 SAMEA3733284 ERX1298770 ERR1226558 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C2 0 A horizon 22.9 NA NA 0.0 NA NA
OC341B OL341 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040434 SAMEA3733285 ERX1298771 ERR1226559 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C2 0 A horizon 22.1 NA NA 0.0 NA NA
OC342B OL342 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040435 SAMEA3733286 ERX1298772 ERR1226560 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C2 0 A horizon 20.3 NA NA 0.0 NA NA
OC343B OL343 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040436 SAMEA3733287 ERX1298773 ERR1226561 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 O horizon 54.7 NA NA 0.0 NA NA
OC344B OL344 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040437 SAMEA3733288 ERX1298774 ERR1226562 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 O horizon 58.7 NA NA 0.0 NA NA
OC345B OL345 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040438 SAMEA3733289 ERX1298775 ERR1226563 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 O horizon 57.4 NA NA 0.0 NA NA
OC346B OL346 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040439 SAMEA3733290 ERX1298776 ERR1226564 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 A horizon 26.2 NA NA 0.0 NA NA
OC347B OL347 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040440 SAMEA3733291 ERX1298777 ERR1226565 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 A horizon 28.0 NA NA 0.0 NA NA
OC348B OL348 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040441 SAMEA3733292 ERX1298778 ERR1226566 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 C1 0 A horizon 26.5 NA NA 0.0 NA NA
OC352B OL352 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040442 SAMEA3733293 ERX1298779 ERR1226567 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C1 0 A horizon 23.9 NA NA 0.0 NA NA
OC353B OL353 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040443 SAMEA3733294 ERX1298780 ERR1226568 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C1 0 A horizon 18.4 NA NA 0.0 NA NA
OC354B OL354 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040444 SAMEA3733295 ERX1298781 ERR1226569 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM3 C1 0 A horizon 18.9 NA NA 0.0 NA NA
OC355B OL355 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040445 SAMEA3733296 ERX1298782 ERR1226570 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 56.5 NA NA 0.0 NA NA
OC356B OL356 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040446 SAMEA3733297 ERX1298783 ERR1226571 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 62.0 NA NA 0.0 NA NA
OC357B OL357 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040447 SAMEA3733298 ERX1298784 ERR1226572 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 O horizon 62.1 NA NA 0.0 NA NA
OC358B OL358 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040448 SAMEA3733299 ERX1298785 ERR1226573 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 23.0 NA NA 0.0 NA NA
OC359B OL359 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040449 SAMEA3733300 ERX1298786 ERR1226574 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 20.6 NA NA 0.0 NA NA
OC360B OL360 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040450 SAMEA3733301 ERX1298787 ERR1226575 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2010-06-26 50.88 -120.35 Canada 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF REF 0 A horizon 20.8 NA NA 0.0 NA NA
SL121B SL121 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040451 SAMEA3733302 ERX1298788 ERR1226576 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 63.0 20.7 0.6 5.2 1.6 35.0
SL122B SL122 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040452 SAMEA3733303 ERX1298789 ERR1226577 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 57.0 20.7 0.6 5.2 1.6 35.0
SL123B SL123 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040453 SAMEA3733304 ERX1298790 ERR1226578 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 61.0 20.7 0.6 5.2 1.6 35.0
SL124B SL124 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040454 SAMEA3733305 ERX1298791 ERR1226579 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 30.0 0.9 0.1 5.4 1.6 18.4
SL125B SL125 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040455 SAMEA3733306 ERX1298792 ERR1226580 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 30.0 0.9 0.1 5.4 1.6 18.4
SL126B SL126 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040456 SAMEA3733307 ERX1298793 ERR1226581 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 30.0 0.9 0.1 5.4 1.6 18.4
SL127B SL127 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040457 SAMEA3733308 ERX1298794 ERR1226582 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 60.0 22.3 0.6 5.1 1.6 38.4
SL128B SL128 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040458 SAMEA3733309 ERX1298795 ERR1226583 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 59.0 22.3 0.6 5.1 1.6 38.4
SL129B SL129 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040459 SAMEA3733310 ERX1298796 ERR1226584 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 62.0 22.3 0.6 5.1 1.6 38.4
SL130B SL130 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040460 SAMEA3733311 ERX1298797 ERR1226585 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 32.0 1.0 0.1 5.5 1.6 19.4
SL131B SL131 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040461 SAMEA3733312 ERX1298798 ERR1226586 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 32.0 1.0 0.1 5.5 1.6 19.4
SL132B SL132 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040462 SAMEA3733313 ERX1298799 ERR1226587 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 36.0 1.0 0.1 5.5 1.6 19.4
SL133B SL133 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040463 SAMEA3733314 ERX1298800 ERR1226588 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 50.0 18.8 0.5 5.3 1.8 36.2
SL134B SL134 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040464 SAMEA3733315 ERX1298801 ERR1226589 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 68.0 18.8 0.5 5.3 1.8 36.2
SL135B SL135 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040465 SAMEA3733316 ERX1298802 ERR1226590 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 67.0 18.8 0.5 5.3 1.8 36.2
SL136B SL136 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040466 SAMEA3733317 ERX1298803 ERR1226591 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 31.0 0.8 0.1 5.6 1.8 16.2
SL137B SL137 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040467 SAMEA3733318 ERX1298804 ERR1226592 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 33.0 0.8 0.1 5.6 1.8 16.2
SL138B SL138 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040468 SAMEA3733319 ERX1298805 ERR1226593 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 32.0 0.8 0.1 5.6 1.8 16.2
SL139B SL139 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040469 SAMEA3733320 ERX1298806 ERR1226594 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 56.0 17.5 0.5 5.2 1.7 34.3
SL140B SL140 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040470 SAMEA3733321 ERX1298807 ERR1226595 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 57.0 17.5 0.5 5.2 1.7 34.3
SL141B SL141 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040471 SAMEA3733322 ERX1298808 ERR1226596 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 58.0 17.5 0.5 5.2 1.7 34.3
SL142B SL142 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040472 SAMEA3733323 ERX1298809 ERR1226597 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 33.0 0.9 0.1 5.5 1.7 18.2
SL143B SL143 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040473 SAMEA3733324 ERX1298810 ERR1226598 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 35.0 0.9 0.1 5.5 1.7 18.2
SL144B SL144 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040474 SAMEA3733325 ERX1298811 ERR1226599 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 28.0 0.9 0.1 5.5 1.7 18.2
SL145B SL145 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040475 SAMEA3733326 ERX1298812 ERR1226600 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 55.0 19.9 0.5 5.4 1.7 39.0
SL146B SL146 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040476 SAMEA3733327 ERX1298813 ERR1226601 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 54.0 19.9 0.5 5.4 1.7 39.0
SL147B SL147 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040477 SAMEA3733328 ERX1298814 ERR1226602 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 62.0 19.9 0.5 5.4 1.7 39.0
SL148B SL148 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040478 SAMEA3733329 ERX1298815 ERR1226603 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 33.0 1.4 0.1 5.6 1.7 19.6
SL149B SL149 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040479 SAMEA3733330 ERX1298816 ERR1226604 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 32.0 1.4 0.1 5.6 1.7 19.6
SL150B SL150 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040480 SAMEA3733331 ERX1298817 ERR1226605 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 31.0 1.4 0.1 5.6 1.7 19.6
SL152B SL152 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040481 SAMEA3733332 ERX1298818 ERR1226606 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 54.0 17.9 0.5 5.2 1.7 33.2
SL153B SL153 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040482 SAMEA3733333 ERX1298819 ERR1226607 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 63.0 17.9 0.5 5.2 1.7 33.2
SL154B SL154 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040483 SAMEA3733334 ERX1298820 ERR1226608 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 28.0 1.1 0.1 5.5 1.7 17.8
SL155B SL155 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040484 SAMEA3733335 ERX1298821 ERR1226609 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 34.0 1.1 0.1 5.5 1.7 17.8
SL156B SL156 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040485 SAMEA3733336 ERX1298822 ERR1226610 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 32.0 1.1 0.1 5.5 1.7 17.8
SL160B SL160 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040486 SAMEA3733337 ERX1298823 ERR1226611 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 33.0 0.9 0.1 5.6 1.7 18.2
SL161B SL161 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040487 SAMEA3733338 ERX1298824 ERR1226612 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 33.0 0.9 0.1 5.6 1.7 18.2
SL162B SL162 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040488 SAMEA3733339 ERX1298825 ERR1226613 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 33.0 0.9 0.1 5.6 1.7 18.2
SL166B SL166 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040489 SAMEA3733340 ERX1298826 ERR1226614 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 32.0 1.1 0.1 5.5 1.7 18.2
SL167B SL167 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040490 SAMEA3733341 ERX1298827 ERR1226615 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 32.0 1.1 0.1 5.5 1.7 18.2
SL168B SL168 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040491 SAMEA3733342 ERX1298828 ERR1226616 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 31.0 1.1 0.1 5.5 1.7 18.2
SL172B SL172 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040492 SAMEA3733343 ERX1298829 ERR1226617 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 32.0 0.9 0.1 5.7 1.7 18.0
SL173B SL173 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040493 SAMEA3733344 ERX1298830 ERR1226618 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 30.0 0.9 0.1 5.7 1.7 18.0
SL174B SL174 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040494 SAMEA3733345 ERX1298831 ERR1226619 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 32.0 0.9 0.1 5.7 1.7 18.0
SL175B SL175 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040495 SAMEA3733346 ERX1298832 ERR1226620 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 85.0 18.9 0.6 5.4 NA 33.7
SL176B SL176 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040496 SAMEA3733347 ERX1298833 ERR1226621 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 73.0 18.9 0.6 5.4 NA 33.7
SL177B SL177 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040497 SAMEA3733348 ERX1298834 ERR1226622 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.1 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 71.0 18.9 0.6 5.4 NA 33.7
SL178B SL178 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040498 SAMEA3733349 ERX1298835 ERR1226623 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 36.0 0.9 0.1 5.8 NA 17.4
SL179B SL179 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040499 SAMEA3733350 ERX1298836 ERR1226624 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 36.0 0.9 0.1 5.8 NA 17.4
SL180B SL180 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040500 SAMEA3733351 ERX1298837 ERR1226625 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2009-08-14 52.32 -121.92 Canada 0.3 1050 3.8 146-193 Orthic Gray Luvisol Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 34.0 0.9 0.1 5.8 NA 17.4
TO061B TO061 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040501 SAMEA3733352 ERX1298838 ERR1226626 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 58.0 33.5 1.0 5.1 1.5 32.5
TO062B TO062 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040502 SAMEA3733353 ERX1298839 ERR1226627 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 52.0 33.5 1.0 5.1 1.5 32.5
TO063B TO063 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040503 SAMEA3733354 ERX1298840 ERR1226628 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 O horizon 56.0 33.5 1.0 5.1 1.5 32.5
TO064B TO064 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040504 SAMEA3733355 ERX1298841 ERR1226629 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 20.0 2.2 0.1 5.7 1.5 21.6
TO065B TO065 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040505 SAMEA3733356 ERX1298842 ERR1226630 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 17.0 2.2 0.1 5.7 1.5 21.6
TO066B TO066 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040506 SAMEA3733357 ERX1298843 ERR1226631 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C0 0 A horizon 15.0 2.2 0.1 5.7 1.5 21.6
TO067B TO067 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040507 SAMEA3733358 ERX1298844 ERR1226632 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 58.0 26.4 0.9 4.8 1.5 28.7
TO068B TO068 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040508 SAMEA3733359 ERX1298845 ERR1226633 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 47.0 26.4 0.9 4.8 1.5 28.7
TO069B TO069 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040509 SAMEA3733360 ERX1298846 ERR1226634 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 O horizon 43.0 26.4 0.9 4.8 1.5 28.7
TO070B TO070 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040510 SAMEA3733361 ERX1298847 ERR1226635 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 25.0 3.3 0.2 5.0 1.5 20.3
TO071B TO071 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040511 SAMEA3733362 ERX1298848 ERR1226636 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 19.0 3.3 0.2 5.0 1.5 20.3
TO072B TO072 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040512 SAMEA3733363 ERX1298849 ERR1226637 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C0 0 A horizon 27.0 3.3 0.2 5.0 1.5 20.3
TO076B TO076 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040513 SAMEA3733364 ERX1298850 ERR1226638 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 20.0 2.2 0.1 5.0 1.6 24.3
TO077B TO077 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040514 SAMEA3733365 ERX1298851 ERR1226639 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 19.0 2.2 0.1 5.0 1.6 24.3
TO078B TO078 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040515 SAMEA3733366 ERX1298852 ERR1226640 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C0 0 A horizon 18.0 2.2 0.1 5.0 1.6 24.3
TO079B TO079 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040516 SAMEA3733367 ERX1298853 ERR1226641 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 52.0 27.6 0.8 4.7 1.8 34.9
TO080B TO080 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040517 SAMEA3733368 ERX1298854 ERR1226642 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 66.0 27.6 0.8 4.7 1.8 34.9
TO081B TO081 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040518 SAMEA3733369 ERX1298855 ERR1226643 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 O horizon 69.0 27.6 0.8 4.7 1.8 34.9
TO082B TO082 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040519 SAMEA3733370 ERX1298856 ERR1226644 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 30.0 1.9 0.1 4.9 1.8 21.1
TO083B TO083 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040520 SAMEA3733371 ERX1298857 ERR1226645 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 25.0 1.9 0.1 4.9 1.8 21.1
TO084B TO084 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040521 SAMEA3733372 ERX1298858 ERR1226646 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C1 0 A horizon 25.0 1.9 0.1 4.9 1.8 21.1
TO085B TO085 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040522 SAMEA3733373 ERX1298859 ERR1226647 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 68.0 37.1 1.2 4.9 1.7 32.0
TO086B TO086 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040523 SAMEA3733374 ERX1298860 ERR1226648 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 68.0 37.1 1.2 4.9 1.7 32.0
TO087B TO087 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040524 SAMEA3733375 ERX1298861 ERR1226649 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 O horizon 56.0 37.1 1.2 4.9 1.7 32.0
TO088B TO088 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040525 SAMEA3733376 ERX1298862 ERR1226650 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 18.0 1.9 0.1 4.9 1.7 21.6
TO089B TO089 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040526 SAMEA3733377 ERX1298863 ERR1226651 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 22.0 1.9 0.1 4.9 1.7 21.6
TO090B TO090 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040527 SAMEA3733378 ERX1298864 ERR1226652 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C1 0 A horizon 20.0 1.9 0.1 4.9 1.7 21.6
TO094B TO094 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040528 SAMEA3733379 ERX1298865 ERR1226653 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 16.0 1.7 0.1 5.5 1.7 21.0
TO095B TO095 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040529 SAMEA3733380 ERX1298866 ERR1226654 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 17.0 1.7 0.1 5.5 1.7 21.0
TO096B TO096 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040530 SAMEA3733381 ERX1298867 ERR1226655 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C1 0 A horizon 15.0 1.7 0.1 5.5 1.7 21.0
TO097B TO097 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040531 SAMEA3733382 ERX1298868 ERR1226656 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 60.0 35.6 0.9 5.1 1.5 37.9
TO098B TO098 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040532 SAMEA3733383 ERX1298869 ERR1226657 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 64.0 35.6 0.9 5.1 1.5 37.9
TO099B TO099 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040533 SAMEA3733384 ERX1298870 ERR1226658 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 O horizon 66.0 35.6 0.9 5.1 1.5 37.9
TO100B TO100 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040534 SAMEA3733385 ERX1298871 ERR1226659 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 21.0 2.3 0.1 5.2 1.5 20.7
TO101B TO101 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040535 SAMEA3733386 ERX1298872 ERR1226660 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 22.0 2.3 0.1 5.2 1.5 20.7
TO102B TO102 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040536 SAMEA3733387 ERX1298873 ERR1226661 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM1 C2 0 A horizon 17.0 2.3 0.1 5.2 1.5 20.7
TO103B TO103 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040537 SAMEA3733388 ERX1298874 ERR1226662 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 86.0 30.6 0.9 5.1 1.8 34.8
TO104B TO104 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040538 SAMEA3733389 ERX1298875 ERR1226663 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 74.0 30.6 0.9 5.1 1.8 34.8
TO105B TO105 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040539 SAMEA3733390 ERX1298876 ERR1226664 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 O horizon 64.0 30.6 0.9 5.1 1.8 34.8
TO106B TO106 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040540 SAMEA3733391 ERX1298877 ERR1226665 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 18.0 3.1 0.2 5.1 1.8 19.6
TO107B TO107 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040541 SAMEA3733392 ERX1298878 ERR1226666 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 27.0 3.1 0.2 5.1 1.8 19.6
TO108B TO108 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040542 SAMEA3733393 ERX1298879 ERR1226667 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM2 C2 0 A horizon 18.0 3.1 0.2 5.1 1.8 19.6
TO112B TO112 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040543 SAMEA3733394 ERX1298880 ERR1226668 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 20.0 1.8 0.1 5.7 1.6 19.5
TO113B TO113 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040544 SAMEA3733395 ERX1298881 ERR1226669 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 16.0 1.8 0.1 5.7 1.6 19.5
TO114B TO114 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040545 SAMEA3733396 ERX1298882 ERR1226670 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer OM3 C2 0 A horizon 18.0 1.8 0.1 5.7 1.6 19.5
TO115B TO115 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040546 SAMEA3733397 ERX1298883 ERR1226671 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 79.0 44.8 1.1 4.4 NA 42.3
TO116B TO116 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040547 SAMEA3733398 ERX1298884 ERR1226672 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 76.0 44.8 1.1 4.4 NA 42.3
TO117B TO117 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040548 SAMEA3733399 ERX1298885 ERR1226673 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.1 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 O horizon 72.0 44.8 1.1 4.4 NA 42.3
TO118B TO118 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040549 SAMEA3733400 ERX1298886 ERR1226674 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 20.0 1.1 0.1 5.0 NA 22.2
TO119B TO119 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040550 SAMEA3733401 ERX1298887 ERR1226675 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 19.0 1.1 0.1 5.0 NA 22.2
TO120B TO120 SBSBC British Columbia TO Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1040551 SAMEA3733402 ERX1298888 ERR1226676 16S rRNA V1-V3 NA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2008-07-11 52.32 -126.31 Canada 0.3 1100 1.7 146-193 Orthic Gray Luvisol, Gleyed Gray Luvisol Lodgepole pine, Subalpine fir, Interior spruce Dfc, Boreal cool summer REF REF 0 A horizon 25.0 1.1 0.1 5.0 NA 22.2
A7001B A7001 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662612 SAMEA3261616 ERX708859 ERR765586 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 48.1 42.5 1.1 5.4 0.2 37.9
A7002B A7002 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662613 SAMEA3261617 ERX708860 ERR765587 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 18.4 0.6 0.0 5.7 1.3 16.3
A7003B A7003 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662614 SAMEA3261618 ERX708861 ERR765588 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 60.8 31.2 0.8 5.5 0.2 37.5
A7004B A7004 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662615 SAMEA3261619 ERX708862 ERR765589 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 16.4 1.2 0.1 6.0 1.0 20.1
A7008B A7008 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662616 SAMEA3261620 ERX708863 ERR765590 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 16.4 2.4 0.1 5.5 1.2 23.9
A7009B A7009 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662617 SAMEA3261621 ERX708864 ERR765591 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 29.7 34.9 0.9 4.4 0.2 39.8
A7010B A7010 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662618 SAMEA3261622 ERX708865 ERR765592 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 13.1 1.1 0.1 5.6 1.0 19.8
A7011B A7011 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662619 SAMEA3261623 ERX708866 ERR765593 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 33.6 33.8 0.9 5.1 0.2 38.1
A7012B A7012 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662620 SAMEA3261624 ERX708867 ERR765594 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 18.9 1.4 0.1 5.7 1.0 21.5
A7015B A7015 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662621 SAMEA3261625 ERX708868 ERR765595 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 37.0 37.3 1.0 5.1 0.2 39.3
A7016B A7016 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662622 SAMEA3261626 ERX708869 ERR765596 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 25.4 2.5 0.1 5.5 1.1 21.3
A7019B A7019 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662623 SAMEA3261627 ERX708870 ERR765597 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 50.0 46.9 1.2 4.3 0.2 40.1
A7020B A7020 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662624 SAMEA3261628 ERX708871 ERR765598 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 20.4 2.0 0.1 5.5 1.3 21.6
A7021B A7021 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662625 SAMEA3261629 ERX708872 ERR765599 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 45.1 40.5 1.2 4.5 0.2 33.7
A7022B A7022 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662626 SAMEA3261630 ERX708873 ERR765600 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 17.1 1.2 0.1 5.6 1.4 24.2
A7023B A7023 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662627 SAMEA3261631 ERX708874 ERR765601 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 63.6 44.9 1.1 4.5 0.2 42.1
A7024B A7024 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662628 SAMEA3261632 ERX708875 ERR765602 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 26.4 1.1 0.0 5.8 1.5 27.3
A7025B A7025 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662629 SAMEA3261633 ERX708876 ERR765603 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 56.8 45.0 1.1 4.3 0.1 40.6
A7026B A7026 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662630 SAMEA3261634 ERX708877 ERR765604 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 26.3 1.4 0.1 5.3 1.1 21.4
A7027B A7027 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662631 SAMEA3261635 ERX708878 ERR765605 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 57.6 44.7 1.0 4.4 0.1 44.4
A7028B A7028 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662632 SAMEA3261636 ERX708879 ERR765606 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 25.4 2.1 0.1 5.3 0.9 24.3
A7029B A7029 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662633 SAMEA3261637 ERX708880 ERR765607 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.1 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 58.1 40.7 1.0 4.2 0.2 40.2
A7030B A7030 BSON Ontario A7 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662634 SAMEA3261638 ERX708881 ERR765608 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-03 49.07 -89.41 Canada 0.3 445 2.4 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 16.0 2.4 0.1 5.2 0.9 20.3
A8031B A8031 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662635 SAMEA3261639 ERX708882 ERR765609 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 53.8 41.4 1.2 4.6 0.2 35.4
A8032B A8032 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662636 SAMEA3261640 ERX708883 ERR765610 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 22.8 4.5 0.2 4.7 1.0 24.5
A8035B A8035 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662637 SAMEA3261641 ERX708884 ERR765611 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 50.6 32.3 0.8 5.1 0.2 38.4
A8036B A8036 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662638 SAMEA3261642 ERX708885 ERR765612 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 13.5 0.8 0.0 5.6 1.7 21.6
A8038B A8038 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662640 SAMEA3261644 ERX708887 ERR765614 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 19.5 1.3 0.1 5.0 1.3 20.8
A8039B A8039 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662641 SAMEA3261645 ERX708888 ERR765615 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 70.0 43.8 1.3 4.8 0.3 34.2
A8040B A8040 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662642 SAMEA3261646 ERX708889 ERR765616 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 25.5 1.6 0.1 5.4 1.3 21.6
A8041B A8041 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662643 SAMEA3261647 ERX708890 ERR765617 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 43.2 42.0 1.2 5.0 0.1 35.4
A8042B A8042 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662644 SAMEA3261648 ERX708891 ERR765618 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 18.1 2.1 0.1 5.2 1.6 20.9
A8045B A8045 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662645 SAMEA3261649 ERX708892 ERR765619 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 36.2 41.6 1.2 4.7 0.2 34.2
A8046B A8046 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662646 SAMEA3261650 ERX708893 ERR765620 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 24.0 2.1 0.1 5.3 1.1 21.7
A8047B A8047 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662647 SAMEA3261651 ERX708894 ERR765621 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 52.5 41.7 1.2 4.5 0.3 35.5
A8048B A8048 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662648 SAMEA3261652 ERX708895 ERR765622 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 21.1 0.9 0.0 5.4 1.7 23.6
A8049B A8049 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662649 SAMEA3261653 ERX708896 ERR765623 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 47.8 30.4 0.8 4.8 0.2 39.4
A8050B A8050 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662650 SAMEA3261654 ERX708897 ERR765624 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 21.5 1.3 0.1 5.7 1.7 20.3
A8053B A8053 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662651 SAMEA3261655 ERX708898 ERR765625 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 52.1 37.3 0.8 4.5 0.2 47.4
A8054B A8054 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662652 SAMEA3261656 ERX708899 ERR765626 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 23.4 1.7 0.1 5.4 1.3 23.7
A8055B A8055 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662653 SAMEA3261657 ERX708900 ERR765627 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 73.3 45.8 1.1 4.1 0.2 41.8
A8056B A8056 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662654 SAMEA3261658 ERX708901 ERR765628 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 26.0 2.5 0.1 5.2 1.0 23.1
A8057B A8057 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662655 SAMEA3261659 ERX708902 ERR765629 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 75.7 44.3 1.0 4.7 0.1 43.8
A8058B A8058 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662656 SAMEA3261660 ERX708903 ERR765630 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 27.5 3.3 0.1 4.9 0.8 27.3
A8059B A8059 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662657 SAMEA3261661 ERX708904 ERR765631 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.1 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 73.2 45.7 1.1 4.2 0.1 43.5
A8060B A8060 BSON Ontario A8 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662658 SAMEA3261662 ERX708905 ERR765632 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-04 49.08 -89.38 Canada 0.3 450 1.8 266 Orthic Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 28.8 1.7 0.1 5.2 1.0 18.4
A9061B A9061 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662659 SAMEA3261663 ERX708906 ERR765633 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 59.8 39.6 1.1 5.2 0.2 34.6
A9062B A9062 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662660 SAMEA3261664 ERX708907 ERR765634 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 20.3 3.3 0.1 5.4 0.9 23.5
A9063B A9063 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662661 SAMEA3261665 ERX708908 ERR765635 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 59.2 35.3 1.1 5.4 0.2 31.9
A9064B A9064 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662662 SAMEA3261666 ERX708909 ERR765636 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 24.2 2.2 0.1 5.6 1.2 21.2
A9067B A9067 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662663 SAMEA3261667 ERX708910 ERR765637 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 53.0 32.6 0.9 5.4 0.2 37.2
A9068B A9068 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662664 SAMEA3261668 ERX708911 ERR765638 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 22.8 2.3 0.1 5.8 1.2 18.3
A9069B A9069 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662665 SAMEA3261669 ERX708912 ERR765639 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 42.5 45.5 1.3 4.9 0.3 36.5
A9070B A9070 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662666 SAMEA3261670 ERX708913 ERR765640 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 20.2 0.7 0.0 5.8 1.2 17.5
A9073B A9073 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662667 SAMEA3261671 ERX708914 ERR765641 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 O horizon 64.4 45.1 1.1 5.0 0.2 40.2
A9074B A9074 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662668 SAMEA3261672 ERX708915 ERR765642 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM2 C0 0 A horizon 32.1 2.8 0.1 5.3 1.2 24.4
A9075B A9075 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662669 SAMEA3261673 ERX708916 ERR765643 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 47.0 42.7 0.9 4.9 0.2 47.4
A9076B A9076 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662670 SAMEA3261674 ERX708917 ERR765644 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 20.8 1.5 0.1 5.6 1.2 19.3
A9077B A9077 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662671 SAMEA3261675 ERX708918 ERR765645 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 41.7 27.7 0.7 5.8 0.2 40.1
A9078B A9078 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662672 SAMEA3261676 ERX708919 ERR765646 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 14.9 0.7 0.0 6.0 1.3 18.6
A9081B A9081 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662673 SAMEA3261677 ERX708920 ERR765647 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 O horizon 76.4 13.4 0.3 5.3 0.2 46.2
A9082B A9082 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662674 SAMEA3261678 ERX708921 ERR765648 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM3 C0 0 A horizon 18.6 1.6 0.1 6.1 1.1 19.9
A9083B A9083 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662675 SAMEA3261679 ERX708922 ERR765649 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 O horizon 69.0 29.0 0.9 5.4 0.2 30.9
A9084B A9084 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662676 SAMEA3261680 ERX708923 ERR765650 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer OM1 C0 0 A horizon 25.6 2.8 0.1 5.4 1.2 27.8
A9085B A9085 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662677 SAMEA3261681 ERX708924 ERR765651 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 64.4 43.9 1.2 4.8 0.1 35.7
A9086B A9086 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662678 SAMEA3261682 ERX708925 ERR765652 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 28.2 1.9 0.1 5.4 1.2 18.9
A9087B A9087 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662679 SAMEA3261683 ERX708926 ERR765653 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 57.4 45.5 1.1 4.8 0.1 39.9
A9088B A9088 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662680 SAMEA3261684 ERX708927 ERR765654 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 30.4 1.4 0.1 5.9 1.4 20.1
A9089B A9089 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662681 SAMEA3261685 ERX708928 ERR765655 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.1 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 O horizon 71.0 44.2 1.0 4.7 0.1 43.1
A9090B A9090 BSON Ontario A9 Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662682 SAMEA3261686 ERX708929 ERR765656 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-05 49.07 -89.39 Canada 0.3 442 1.5 266 Gleyed Dystric Brunisol Black Spruce Dfb, Humid Continental warm summer REF REF 0 A horizon 25.0 1.2 0.1 5.6 1.5 22.3
BL025B BL025 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662701 SAMEA3261705 ERX708948 ERR765675 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 18.4 NA NA 4.8 NA NA
BL026B BL026 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662702 SAMEA3261706 ERX708949 ERR765676 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 22.0 5.5 0.3 5.7 NA 19.8
BL027B BL027 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662703 SAMEA3261707 ERX708950 ERR765677 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 16.7 NA NA 4.9 NA NA
BL028B BL028 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662704 SAMEA3261708 ERX708951 ERR765678 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 21.0 5.5 0.3 5.9 NA 19.8
BL029B BL029 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662705 SAMEA3261709 ERX708952 ERR765679 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 18.9 NA NA 4.7 NA NA
BL030B BL030 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662706 SAMEA3261710 ERX708953 ERR765680 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 23.7 5.5 0.3 5.9 NA 19.8
BL031B BL031 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662707 SAMEA3261711 ERX708954 ERR765681 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 28.6 NA NA 5.7 NA NA
BL032B BL032 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662708 SAMEA3261712 ERX708955 ERR765682 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 21.0 5.4 0.3 5.8 NA 20.6
BL033B BL033 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662709 SAMEA3261713 ERX708956 ERR765683 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 21.7 NA NA 5.2 NA NA
BL034B BL034 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662710 SAMEA3261714 ERX708957 ERR765684 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 20.5 5.4 0.3 5.3 NA 20.6
BL035B BL035 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662711 SAMEA3261715 ERX708958 ERR765685 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 16.4 NA NA 5.1 NA NA
BL036B BL036 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662712 SAMEA3261716 ERX708959 ERR765686 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 22.3 5.4 0.3 5.7 NA 20.6
BL037B BL037 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662713 SAMEA3261717 ERX708960 ERR765687 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 21.1 NA NA 5.2 NA NA
BL038B BL038 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662714 SAMEA3261718 ERX708961 ERR765688 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 21.7 5.3 0.3 5.4 NA 18.9
BL039B BL039 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662715 SAMEA3261719 ERX708962 ERR765689 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 24.4 NA NA 5.3 NA NA
BL040B BL040 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662716 SAMEA3261720 ERX708963 ERR765690 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 22.2 5.3 0.3 5.9 NA 18.9
BL041B BL041 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662717 SAMEA3261721 ERX708964 ERR765691 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 23.2 NA NA 5.1 NA NA
BL042B BL042 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662718 SAMEA3261722 ERX708965 ERR765692 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 21.5 5.3 0.3 5.4 NA 18.9
BL043B BL043 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662719 SAMEA3261723 ERX708966 ERR765693 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 27.0 NA NA 4.5 NA NA
BL044B BL044 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662720 SAMEA3261724 ERX708967 ERR765694 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 17.8 6.3 0.3 5.5 NA 20.3
BL045B BL045 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662721 SAMEA3261725 ERX708968 ERR765695 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 25.8 NA NA 5.3 NA NA
BL046B BL046 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662722 SAMEA3261726 ERX708969 ERR765696 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 17.5 6.3 0.3 5.5 NA 20.3
BL047B BL047 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662723 SAMEA3261727 ERX708970 ERR765697 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 29.8 NA NA 4.9 NA NA
BL048B BL048 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662724 SAMEA3261728 ERX708971 ERR765698 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 15.3 6.3 0.3 6.0 NA 20.3
BR049B BR049 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662725 SAMEA3261729 ERX708972 ERR765699 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 54.2 41.6 1.6 5.4 NA 25.5
BR050B BR050 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662726 SAMEA3261730 ERX708973 ERR765700 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 35.0 8.5 0.3 5.9 NA 25.3
BR051B BR051 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662727 SAMEA3261731 ERX708974 ERR765701 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 55.1 38.6 1.4 4.3 NA 27.0
BR052B BR052 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662728 SAMEA3261732 ERX708975 ERR765702 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 33.9 7.8 0.3 5.2 NA 25.1
BR053B BR053 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662729 SAMEA3261733 ERX708976 ERR765703 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 58.0 39.0 1.3 4.4 NA 30.4
BR054B BR054 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662730 SAMEA3261734 ERX708977 ERR765704 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 31.7 6.2 0.2 5.3 NA 24.9
BR055B BR055 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662731 SAMEA3261735 ERX708978 ERR765705 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 50.0 26.4 1.1 5.7 NA 23.6
BR056B BR056 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662732 SAMEA3261736 ERX708979 ERR765706 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 35.6 5.7 0.3 6.1 NA 20.9
BR057B BR057 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662733 SAMEA3261737 ERX708980 ERR765707 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 50.6 35.1 1.2 5.0 NA 28.1
BR058B BR058 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662734 SAMEA3261738 ERX708981 ERR765708 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 35.4 5.7 0.3 6.3 NA 20.9
BR059B BR059 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662735 SAMEA3261739 ERX708982 ERR765709 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 45.5 27.8 1.2 5.9 NA 24.0
BR060B BR060 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662736 SAMEA3261740 ERX708983 ERR765710 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 37.0 5.7 0.3 6.1 NA 20.9
BR061B BR061 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662737 SAMEA3261741 ERX708984 ERR765711 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 40.0 16.4 0.6 5.8 NA 27.1
BR062B BR062 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662738 SAMEA3261742 ERX708985 ERR765712 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 33.6 6.7 0.3 5.5 NA 20.7
BR063B BR063 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662739 SAMEA3261743 ERX708986 ERR765713 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 50.0 19.2 0.7 4.8 NA 26.8
BR064B BR064 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662740 SAMEA3261744 ERX708987 ERR765714 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 33.4 5.9 0.3 5.4 NA 19.1
BR065B BR065 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662741 SAMEA3261745 ERX708988 ERR765715 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 50.8 27.1 1.1 5.6 NA 25.1
BR066B BR066 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662742 SAMEA3261746 ERX708989 ERR765716 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 34.7 6.1 0.3 5.8 NA 19.1
BR067B BR067 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662743 SAMEA3261747 ERX708990 ERR765717 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 60.7 39.2 1.2 5.0 NA 31.6
BR068B BR068 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662744 SAMEA3261748 ERX708991 ERR765718 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 27.5 6.7 0.3 6.0 NA 23.4
BR069B BR069 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662745 SAMEA3261749 ERX708992 ERR765719 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 47.8 33.3 1.4 6.3 NA 23.7
BR070B BR070 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662746 SAMEA3261750 ERX708993 ERR765720 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 35.5 8.0 0.4 6.7 NA 20.0
BR071B BR071 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662747 SAMEA3261751 ERX708994 ERR765721 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 58.9 42.8 1.4 5.6 NA 30.7
BR072B BR072 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662748 SAMEA3261752 ERX708995 ERR765722 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-06-22 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 31.1 7.0 0.3 6.3 NA 22.4
JE085B JE085 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662749 SAMEA3261753 ERX708996 ERR765723 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 O horizon 33.7 41.5 1.3 3.7 5.7 34.6
JE086B JE086 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662750 SAMEA3261754 ERX708997 ERR765724 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 A horizon 6.1 2.6 0.2 5.0 5.7 15.9
JE087B JE087 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662751 SAMEA3261755 ERX708998 ERR765725 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 O horizon 33.7 41.5 1.3 3.7 5.7 34.6
JE088B JE088 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662752 SAMEA3261756 ERX708999 ERR765726 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 A horizon 9.6 2.6 0.2 5.0 5.7 15.9
JE090B JE090 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662753 SAMEA3261757 ERX709000 ERR765727 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 1 A horizon 8.0 3.0 0.2 5.0 5.7 16.4
JE092B JE092 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662754 SAMEA3261758 ERX709001 ERR765728 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 0 A horizon 8.0 3.0 0.2 5.0 5.7 16.4
JE093B JE093 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662755 SAMEA3261759 ERX709002 ERR765729 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 O horizon 20.0 40.5 1.3 3.7 5.7 32.3
JE094B JE094 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662756 SAMEA3261760 ERX709003 ERR765730 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 A horizon 12.9 2.9 0.2 5.0 5.7 15.9
JE095B JE095 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662757 SAMEA3261761 ERX709004 ERR765731 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 O horizon 32.0 40.5 1.3 3.7 5.7 32.3
JE096B JE096 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662758 SAMEA3261762 ERX709005 ERR765732 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 A horizon 12.5 2.9 0.2 5.0 5.7 15.9
JE098B JE098 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662759 SAMEA3261763 ERX709006 ERR765733 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 1 A horizon 10.9 1.9 0.1 5.2 5.7 13.6
JE100B JE100 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662760 SAMEA3261764 ERX709007 ERR765734 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 0 A horizon 10.6 1.9 0.1 5.2 5.7 13.6
JE101B JE101 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662761 SAMEA3261765 ERX709008 ERR765735 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 O horizon 31.1 38.5 1.2 3.6 5.7 32.7
JE102B JE102 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662762 SAMEA3261766 ERX709009 ERR765736 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 A horizon 7.0 2.1 0.2 5.1 5.7 13.5
JE103B JE103 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662763 SAMEA3261767 ERX709010 ERR765737 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 O horizon 24.5 38.5 1.2 3.6 5.7 32.7
JE104B JE104 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662764 SAMEA3261768 ERX709011 ERR765738 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 A horizon 12.9 2.1 0.2 5.1 5.7 13.5
JE105B JE105 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662765 SAMEA3261769 ERX709012 ERR765739 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 O horizon 27.2 41.4 1.3 3.8 5.7 33.8
JE106B JE106 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662766 SAMEA3261770 ERX709013 ERR765740 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 A horizon 7.1 2.4 0.2 5.1 5.7 13.9
JE107B JE107 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662767 SAMEA3261771 ERX709014 ERR765741 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 O horizon 24.0 41.4 1.3 3.8 5.7 33.8
JE108B JE108 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662768 SAMEA3261772 ERX709015 ERR765742 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 A horizon 12.0 2.4 0.2 5.1 5.7 13.9
JE110B JE110 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662769 SAMEA3261773 ERX709016 ERR765743 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 1 A horizon 13.9 1.9 0.1 5.2 5.7 13.9
JE112B JE112 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662770 SAMEA3261774 ERX709017 ERR765744 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM3 C0 0 A horizon 14.0 1.9 0.1 5.2 5.7 13.9
JE113B JE113 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662771 SAMEA3261775 ERX709018 ERR765745 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 O horizon 49.5 41.6 1.4 3.7 5.7 31.6
JE114B JE114 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662772 SAMEA3261776 ERX709019 ERR765746 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 1 A horizon 11.0 2.6 0.2 5.0 5.7 16.1
JE115B JE115 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662773 SAMEA3261777 ERX709020 ERR765747 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 O horizon 55.9 41.6 1.4 3.7 5.7 31.6
JE116B JE116 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662774 SAMEA3261778 ERX709021 ERR765748 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM2 C0 0 A horizon 16.2 2.6 0.2 5.0 5.7 16.1
JE117B JE117 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662775 SAMEA3261779 ERX709022 ERR765749 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 O horizon 42.1 39.6 1.3 3.8 5.7 33.5
JE118B JE118 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662776 SAMEA3261780 ERX709023 ERR765750 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 1 A horizon 21.4 2.5 0.2 4.9 5.7 15.3
JE119B JE119 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662777 SAMEA3261781 ERX709024 ERR765751 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 O horizon 47.6 39.6 1.3 3.8 5.7 33.5
JE120B JE120 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662778 SAMEA3261782 ERX709025 ERR765752 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer OM1 C0 0 A horizon 9.8 2.5 0.2 4.9 5.7 15.3
JE121B JE121 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662779 SAMEA3261783 ERX709026 ERR765753 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 O horizon 68.9 43.2 1.4 3.6 5.7 30.8
JE122B JE122 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662780 SAMEA3261784 ERX709027 ERR765754 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 A horizon 14.6 2.4 0.2 4.9 5.7 16.4
JE123B JE123 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662781 SAMEA3261785 ERX709028 ERR765755 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 O horizon 47.1 38.1 1.2 3.7 5.7 30.8
JE124B JE124 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662782 SAMEA3261786 ERX709029 ERR765756 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 A horizon 15.0 2.8 0.2 4.9 5.7 17.8
JE125B JE125 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662783 SAMEA3261787 ERX709030 ERR765757 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.1 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 O horizon 73.7 38.9 1.3 3.6 5.7 29.8
JE126B JE126 JPON Ontario JE Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662784 SAMEA3261788 ERX709031 ERR765758 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-03 46.75 -82.25 Canada 0.3 490 2.8 242 NA Jack Pine, Balsam fir, White birch Dfb, Humid Continental cool summer REF REF 0 A horizon 22.3 1.7 0.1 4.8 5.7 16.4
JS043B JS043 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662785 SAMEA3261789 ERX709032 ERR765759 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 O horizon 42.6 44.5 1.1 4.0 7.9 39.6
JS044B JS044 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662786 SAMEA3261790 ERX709033 ERR765760 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 A horizon 7.6 0.8 0.0 5.2 7.9 27.1
JS045B JS045 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662787 SAMEA3261791 ERX709034 ERR765761 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 O horizon 34.0 44.5 1.1 4.0 7.9 39.6
JS046B JS046 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662788 SAMEA3261792 ERX709035 ERR765762 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 A horizon 4.0 0.8 0.0 5.2 7.9 27.1
JS048B JS048 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662789 SAMEA3261793 ERX709036 ERR765763 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 1 A horizon 17.0 0.4 0.0 5.5 7.9 26.6
JS050B JS050 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662790 SAMEA3261794 ERX709037 ERR765764 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 0 A horizon 3.0 0.4 0.0 5.5 7.9 26.6
JS051B JS051 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662791 SAMEA3261795 ERX709038 ERR765765 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 O horizon 46.6 43.1 1.1 3.9 7.9 38.9
JS052B JS052 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662792 SAMEA3261796 ERX709039 ERR765766 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 A horizon 12.7 0.6 0.0 5.3 7.9 26.0
JS053B JS053 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662793 SAMEA3261797 ERX709040 ERR765767 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 O horizon 47.5 43.1 1.1 3.9 7.9 38.9
JS054B JS054 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662794 SAMEA3261798 ERX709041 ERR765768 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 A horizon 6.7 0.6 0.0 5.3 7.9 26.0
JS056B JS056 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662795 SAMEA3261799 ERX709042 ERR765769 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 1 A horizon 11.8 12.7 0.3 5.1 7.9 31.3
JS058B JS058 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662796 SAMEA3261800 ERX709043 ERR765770 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 0 A horizon 11.7 12.7 0.3 5.1 7.9 31.3
JS059B JS059 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662797 SAMEA3261801 ERX709044 ERR765771 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 O horizon 44.7 42.7 1.0 4.0 7.9 42.6
JS060B JS060 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662798 SAMEA3261802 ERX709045 ERR765772 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 A horizon 17.9 1.2 0.1 5.3 7.9 25.6
JS061B JS061 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662799 SAMEA3261803 ERX709046 ERR765773 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 O horizon NA NA NA NA NA NA
JS062B JS062 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662800 SAMEA3261804 ERX709047 ERR765774 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 0 A horizon 6.9 1.2 0.1 5.3 7.9 25.6
JS063B JS063 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662801 SAMEA3261805 ERX709048 ERR765775 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 O horizon 28.4 46.5 1.2 4.1 7.9 40.7
JS064B JS064 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662802 SAMEA3261806 ERX709049 ERR765776 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 A horizon 6.0 1.0 0.0 5.2 7.9 24.1
JS065B JS065 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662803 SAMEA3261807 ERX709050 ERR765777 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 O horizon 36.5 46.5 1.2 4.1 7.9 40.7
JS066B JS066 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662804 SAMEA3261808 ERX709051 ERR765778 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 A horizon 7.8 1.0 0.0 5.2 7.9 24.1
JS068B JS068 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662805 SAMEA3261809 ERX709052 ERR765779 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM2 C0 1 A horizon 13.9 0.8 0.0 5.2 7.9 26.8
JS072B JS072 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662806 SAMEA3261810 ERX709053 ERR765780 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 1 A horizon 9.1 0.4 0.0 5.3 7.9 24.1
JS074B JS074 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662807 SAMEA3261811 ERX709054 ERR765781 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM3 C0 0 A horizon 5.9 0.4 0.0 5.3 7.9 24.1
JS075B JS075 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662808 SAMEA3261812 ERX709055 ERR765782 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 O horizon 32.4 43.4 1.1 3.9 7.9 40.0
JS076B JS076 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662809 SAMEA3261813 ERX709056 ERR765783 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 1 A horizon 5.9 0.8 0.0 5.3 7.9 23.0
JS077B JS077 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662810 SAMEA3261814 ERX709057 ERR765784 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 O horizon 33.7 43.4 1.1 3.9 7.9 40.0
JS078B JS078 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662811 SAMEA3261815 ERX709058 ERR765785 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer OM1 C0 0 A horizon 4.1 0.8 0.0 5.3 7.9 23.0
JS079B JS079 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662812 SAMEA3261816 ERX709059 ERR765786 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 O horizon 46.5 45.7 1.3 3.7 7.9 36.6
JS080B JS080 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662813 SAMEA3261817 ERX709060 ERR765787 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 A horizon 15.7 1.0 0.1 5.2 7.9 16.4
JS082B JS082 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662814 SAMEA3261818 ERX709061 ERR765788 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 A horizon 17.1 1.0 0.0 5.1 7.8 23.8
JS083B JS083 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662815 SAMEA3261819 ERX709062 ERR765789 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.1 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 O horizon 49.1 44.6 1.2 3.6 7.8 35.9
JS084B JS084 JPON Ontario JS Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662816 SAMEA3261820 ERX709063 ERR765790 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-08-04 47.57 -82.85 Canada 0.3 426 1.7 250 Orthic Dystric Brunisol Jack Pine, Black Spruce Dfb, Humid Continental cool summer REF REF 0 A horizon 12.1 1.2 0.1 5.0 7.8 23.2
JW002B JW002 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662817 SAMEA3261821 ERX709064 ERR765791 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 1 A horizon 12.0 2.2 0.1 5.4 7.2 17.8
JW003B JW003 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662818 SAMEA3261822 ERX709065 ERR765792 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 O horizon 37.0 38.3 1.1 4.1 7.2 37.3
JW004B JW004 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662819 SAMEA3261823 ERX709066 ERR765793 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 A horizon 11.0 2.2 0.1 5.4 7.2 17.8
JW005B JW005 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662820 SAMEA3261824 ERX709067 ERR765794 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 O horizon 38.1 36.4 1.1 4.2 6.3 33.0
JW006B JW006 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662821 SAMEA3261825 ERX709068 ERR765795 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 A horizon 15.7 2.7 0.2 5.3 6.3 16.0
JW007B JW007 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662822 SAMEA3261826 ERX709069 ERR765796 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 O horizon 40.0 36.4 1.1 4.2 6.3 33.0
JW008B JW008 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662823 SAMEA3261827 ERX709070 ERR765797 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 A horizon 9.8 2.7 0.2 5.3 6.3 16.0
JW010B JW010 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662824 SAMEA3261828 ERX709071 ERR765798 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 1 A horizon 17.6 1.5 0.1 5.5 8.9 15.6
JW012B JW012 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662825 SAMEA3261829 ERX709072 ERR765799 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 A horizon 13.3 1.5 0.1 5.5 8.9 15.6
JW013B JW013 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662826 SAMEA3261830 ERX709073 ERR765800 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 O horizon 31.0 38.1 1.1 4.1 8.9 36.6
JW014B JW014 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662827 SAMEA3261831 ERX709074 ERR765801 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 A horizon 16.0 1.5 0.1 5.5 8.9 15.6
JW015B JW015 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662828 SAMEA3261832 ERX709075 ERR765802 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 O horizon 29.7 36.9 1.2 4.2 9.8 30.8
JW016B JW016 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662829 SAMEA3261833 ERX709076 ERR765803 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 A horizon 15.2 2.6 0.2 5.4 9.8 16.2
JW017B JW017 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662830 SAMEA3261834 ERX709077 ERR765804 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 O horizon 46.7 36.9 1.2 4.2 9.8 30.8
JW018B JW018 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662831 SAMEA3261835 ERX709078 ERR765805 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 A horizon 14.7 2.6 0.2 5.4 9.8 16.2
JW019B JW019 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662832 SAMEA3261836 ERX709079 ERR765806 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 O horizon 31.4 36.9 1.2 4.2 9.8 30.8
JW020B JW020 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662833 SAMEA3261837 ERX709080 ERR765807 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 A horizon 12.0 2.6 0.2 5.4 9.8 16.2
JW021B JW021 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662834 SAMEA3261838 ERX709081 ERR765808 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 O horizon 43.0 34.6 1.1 4.1 7.7 30.1
JW022B JW022 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662835 SAMEA3261839 ERX709082 ERR765809 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 A horizon 13.7 3.1 0.2 5.3 7.7 14.8
JW023B JW023 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662836 SAMEA3261840 ERX709083 ERR765810 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 O horizon 46.7 34.6 1.1 4.1 7.7 30.1
JW024B JW024 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662837 SAMEA3261841 ERX709084 ERR765811 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 A horizon 12.2 3.1 0.2 5.3 7.7 14.8
JW026B JW026 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662838 SAMEA3261842 ERX709085 ERR765812 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer REF REF 0 A horizon 14.0 3.1 0.2 4.1 7.7 14.8
JW027B JW027 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662839 SAMEA3261843 ERX709086 ERR765813 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 O horizon 33.7 33.8 1.0 4.4 6.3 32.8
JW028B JW028 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662840 SAMEA3261844 ERX709087 ERR765814 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 1 A horizon 13.0 3.3 0.3 5.3 6.3 13.6
JW029B JW029 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662841 SAMEA3261845 ERX709088 ERR765815 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 O horizon 57.0 33.8 1.0 4.4 6.3 32.8
JW030B JW030 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662842 SAMEA3261846 ERX709089 ERR765816 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM1 C0 0 A horizon 13.7 3.3 0.3 5.3 6.3 13.6
JW031B JW031 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662843 SAMEA3261847 ERX709090 ERR765817 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 O horizon 40.4 37.6 1.1 4.0 7.7 33.6
JW032B JW032 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662844 SAMEA3261848 ERX709091 ERR765818 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 A horizon 16.7 3.0 0.4 5.1 7.7 13.9
JW033B JW033 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662845 SAMEA3261849 ERX709092 ERR765819 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 O horizon 60.4 37.6 1.1 4.0 7.7 33.6
JW034B JW034 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662846 SAMEA3261850 ERX709093 ERR765820 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 A horizon 16.3 3.0 0.4 5.1 7.7 13.9
JW035B JW035 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662847 SAMEA3261851 ERX709094 ERR765821 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 O horizon 46.5 35.2 1.1 4.3 9.7 32.5
JW036B JW036 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662848 SAMEA3261852 ERX709095 ERR765822 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 1 A horizon 12.7 2.7 0.5 5.4 9.7 11.1
JW037B JW037 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662849 SAMEA3261853 ERX709096 ERR765823 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.1 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 O horizon 47.5 35.2 1.1 4.3 9.7 32.5
JW038B JW038 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662850 SAMEA3261854 ERX709097 ERR765824 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM2 C0 0 A horizon 12.9 2.7 0.5 5.4 9.7 11.1
JW040B JW040 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662851 SAMEA3261855 ERX709098 ERR765825 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 1 A horizon 19.0 1.3 0.6 5.4 9.0 9.8
JW042B JW042 JPON Ontario JW Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662852 SAMEA3261856 ERX709099 ERR765826 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-07-07 46.42 -83.37 Canada 0.3 228 4.4 248 Orthic Humo-Ferric Podzol Jack Pine, Black Spruce, Red Pine Dfb, Humid Continental cool summer OM3 C0 0 A horizon 14.3 1.3 0.6 5.4 9.0 9.8
LH001B LH001 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662853 SAMEA3261857 ERX709100 ERR765827 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 14.4 44.8 1.0 3.7 NA 44.4
LH002B LH002 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662854 SAMEA3261858 ERX709101 ERR765828 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 18.5 4.8 0.2 5.2 NA 29.6
LH003B LH003 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662855 SAMEA3261859 ERX709102 ERR765829 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 17.2 43.3 0.9 3.6 NA 46.4
LH004B LH004 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662856 SAMEA3261860 ERX709103 ERR765830 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 34.1 6.5 0.2 5.3 NA 32.8
LH005B LH005 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662857 SAMEA3261861 ERX709104 ERR765831 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 O horizon 14.7 40.4 1.1 3.9 NA 35.4
LH006B LH006 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662858 SAMEA3261862 ERX709105 ERR765832 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 C0 0 A horizon 19.0 4.8 0.2 5.5 NA 25.2
LH007B LH007 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662859 SAMEA3261863 ERX709106 ERR765833 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 10.3 25.8 0.8 4.6 NA 34.2
LH008B LH008 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662860 SAMEA3261864 ERX709107 ERR765834 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 17.1 3.6 0.2 6.0 NA 22.3
LH009B LH009 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662861 SAMEA3261865 ERX709108 ERR765835 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 33.7 33.8 1.0 4.5 NA 33.6
LH010B LH010 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662862 SAMEA3261866 ERX709109 ERR765836 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 18.3 3.6 0.2 5.9 NA 22.3
LH011B LH011 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662863 SAMEA3261867 ERX709110 ERR765837 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 O horizon 6.7 29.1 0.8 4.2 NA 34.8
LH012B LH012 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662864 SAMEA3261868 ERX709111 ERR765838 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 C0 0 A horizon 17.7 3.6 0.2 5.7 NA 22.3
LH013B LH013 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662865 SAMEA3261869 ERX709112 ERR765839 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 14.1 36.4 1.1 5.1 NA 34.1
LH014B LH014 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662866 SAMEA3261870 ERX709113 ERR765840 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 17.1 3.9 0.2 5.0 NA 21.6
LH015B LH015 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662867 SAMEA3261871 ERX709114 ERR765841 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 14.0 NA NA 5.8 NA NA
LH016B LH016 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662868 SAMEA3261872 ERX709115 ERR765842 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 17.1 4.3 0.2 6.3 NA 19.2
LH017B LH017 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662869 SAMEA3261873 ERX709116 ERR765843 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 O horizon 14.0 39.5 0.9 5.0 NA 42.1
LH018B LH018 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662870 SAMEA3261874 ERX709117 ERR765844 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 C0 0 A horizon 16.4 3.6 0.2 6.0 NA 20.3
LH019B LH019 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662871 SAMEA3261875 ERX709118 ERR765845 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 21.7 39.7 1.3 5.6 NA 31.0
LH020B LH020 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662872 SAMEA3261876 ERX709119 ERR765846 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 20.1 4.1 0.2 6.6 NA 19.1
LH021B LH021 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662873 SAMEA3261877 ERX709120 ERR765847 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 13.8 31.3 0.9 4.9 NA 35.1
LH022B LH022 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662874 SAMEA3261878 ERX709121 ERR765848 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 18.7 4.6 0.2 6.1 NA 21.6
LH023B LH023 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662875 SAMEA3261879 ERX709122 ERR765849 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 O horizon 13.0 43.0 1.3 5.7 NA 32.0
LH024B LH024 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662876 SAMEA3261880 ERX709123 ERR765850 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2011-09-16 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF REF 0 A horizon 18.9 5.6 0.3 6.5 NA 22.5
TXA001B TXA001 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662877 SAMEA3261881 ERX709124 ERR765851 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 12.2 1.1 0.1 5.0 1.3 18.5
TXA002B TXA002 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662878 SAMEA3261882 ERX709125 ERR765852 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 13.9 1.1 0.1 4.7 1.3 18.5
TXA003B TXA003 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662879 SAMEA3261883 ERX709126 ERR765853 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 13.8 1.1 0.1 4.6 1.3 18.5
TXA004B TXA004 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662880 SAMEA3261884 ERX709127 ERR765854 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 25.5 12.6 0.5 4.7 NA 26.7
TXA005B TXA005 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662881 SAMEA3261885 ERX709128 ERR765855 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 27.8 11.5 0.4 4.7 NA 28.7
TXA006B TXA006 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662882 SAMEA3261886 ERX709129 ERR765856 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 19.0 8.8 0.4 5.0 NA 23.7
TXA007B TXA007 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662883 SAMEA3261887 ERX709130 ERR765857 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 11.6 1.1 0.1 4.7 1.3 18.5
TXA008B TXA008 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662884 SAMEA3261888 ERX709131 ERR765858 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 23.1 1.1 0.1 4.8 1.3 18.5
TXA009B TXA009 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662885 SAMEA3261889 ERX709132 ERR765859 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 12.6 1.1 0.1 5.1 1.3 18.5
TXA010B TXA010 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662886 SAMEA3261890 ERX709133 ERR765860 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 31.9 NA NA 4.8 NA NA
TXA011B TXA011 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662887 SAMEA3261891 ERX709134 ERR765861 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 31.0 NA NA 4.3 NA NA
TXA012B TXA012 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662888 SAMEA3261892 ERX709135 ERR765862 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 19.7 NA NA 4.8 NA NA
TXA013B TXA013 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662889 SAMEA3261893 ERX709136 ERR765863 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 10.5 1.2 0.1 4.6 1.3 23.9
TXA014B TXA014 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662890 SAMEA3261894 ERX709137 ERR765864 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 9.9 1.2 0.1 5.0 1.3 23.9
TXA015B TXA015 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662891 SAMEA3261895 ERX709138 ERR765865 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 8.9 1.2 0.1 4.3 1.3 23.9
TXA016B TXA016 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662892 SAMEA3261896 ERX709139 ERR765866 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 15.0 22.6 0.8 4.5 NA 28.0
TXA017B TXA017 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662893 SAMEA3261897 ERX709140 ERR765867 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 23.3 13.1 0.6 5.7 NA 23.2
TXA018B TXA018 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662894 SAMEA3261898 ERX709141 ERR765868 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 40 NA NA 5.28 NA NA
TXA019B TXA019 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662895 SAMEA3261899 ERX709142 ERR765869 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 9.9 1.2 0.1 4.6 1.3 23.9
TXA021B TXA021 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662896 SAMEA3261900 ERX709143 ERR765870 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 8.6 1.2 0.1 5.1 1.3 23.9
TXA022B TXA022 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662897 SAMEA3261901 ERX709144 ERR765871 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 13.4 NA NA 4.5 NA NA
TXA023B TXA023 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662898 SAMEA3261902 ERX709145 ERR765872 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 24.6 NA NA 4.1 NA NA
TXA024B TXA024 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662899 SAMEA3261903 ERX709146 ERR765873 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 52.8 NA NA 4.6 NA NA
TXA025B TXA025 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662900 SAMEA3261904 ERX709147 ERR765874 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 8.9 0.8 0.0 4.6 1.3 17.8
TXA026B TXA026 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662901 SAMEA3261905 ERX709148 ERR765875 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 8.6 0.8 0.0 4.5 1.3 17.8
TXA027B TXA027 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662902 SAMEA3261906 ERX709149 ERR765876 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 9.5 0.8 0.0 4.4 1.3 17.8
TXA028B TXA028 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662903 SAMEA3261907 ERX709150 ERR765877 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 10.6 9.9 0.4 NA NA 24.4
TXA029B TXA029 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662904 SAMEA3261908 ERX709151 ERR765878 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 26 NA NA 4.67 NA NA
TXA030B TXA030 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662905 SAMEA3261909 ERX709152 ERR765879 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 19.0 13.5 0.5 4.4 NA 29.3
TXA031B TXA031 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662906 SAMEA3261910 ERX709153 ERR765880 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 8.6 0.8 0.0 5.3 1.3 17.8
TXA032B TXA032 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662907 SAMEA3261911 ERX709154 ERR765881 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 9.9 0.8 0.0 4.6 1.3 17.8
TXA033B TXA033 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662908 SAMEA3261912 ERX709155 ERR765882 16S rRNA V1-V3 ACGCGAGTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 11.6 0.8 0.0 4.5 1.3 17.8
TXA034B TXA034 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662909 SAMEA3261913 ERX709156 ERR765883 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 26.0 NA NA 4.5 NA NA
TXA035B TXA035 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662910 SAMEA3261914 ERX709157 ERR765884 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 18.2 NA NA 4.5 NA NA
TXA036B TXA036 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662911 SAMEA3261915 ERX709158 ERR765885 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 16.9 NA NA 4.5 NA NA
TXA037B TXA037 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662912 SAMEA3261916 ERX709159 ERR765886 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 10.4 NA NA NA NA NA
TXA038B TXA038 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662913 SAMEA3261917 ERX709160 ERR765887 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 10.8 NA NA NA NA NA
TXA039B TXA039 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662914 SAMEA3261918 ERX709161 ERR765888 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 10.9 NA NA NA NA NA
TXA040B TXA040 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662915 SAMEA3261919 ERX709162 ERR765889 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 18.9 17.6 0.6 4.7 NA 31.0
TXA041B TXA041 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662916 SAMEA3261920 ERX709163 ERR765890 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 33.8 21.0 0.7 4.4 NA 28.0
TXA042B TXA042 LPTX Texas TXA Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662917 SAMEA3261921 ERX709164 ERR765891 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 26.3 16.9 0.6 4.3 NA 27.2
TXB043B TXB043 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662918 SAMEA3261922 ERX709165 ERR765892 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 18.2 0.9 0.1 5.1 1.3 15.5
TXB044B TXB044 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662919 SAMEA3261923 ERX709166 ERR765893 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 14.7 0.9 0.1 5.5 1.3 15.5
TXB045B TXB045 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662920 SAMEA3261924 ERX709167 ERR765894 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 13.7 0.9 0.1 4.9 1.3 15.5
TXB046B TXB046 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662921 SAMEA3261925 ERX709168 ERR765895 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 29.2 12.8 0.5 5.0 NA 28.0
TXB047B TXB047 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662922 SAMEA3261926 ERX709169 ERR765896 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 32.2 11.3 0.5 4.9 NA 25.0
TXB048B TXB048 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662923 SAMEA3261927 ERX709170 ERR765897 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 23.2 9.0 0.4 5.0 NA 25.2
TXB049B TXB049 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662924 SAMEA3261928 ERX709171 ERR765898 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 16.8 0.9 0.1 5.0 1.3 15.5
TXB050B TXB050 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662925 SAMEA3261929 ERX709172 ERR765899 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 12.0 0.9 0.1 4.7 1.3 15.5
TXB051B TXB051 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662926 SAMEA3261930 ERX709173 ERR765900 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 12.9 0.9 0.1 4.8 1.3 15.5
TXB052B TXB052 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662927 SAMEA3261931 ERX709174 ERR765901 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 20.0 NA NA 5.3 NA NA
TXB053B TXB053 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662928 SAMEA3261932 ERX709175 ERR765902 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 18.8 NA NA 5.6 NA NA
TXB054B TXB054 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662929 SAMEA3261933 ERX709176 ERR765903 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 25.3 NA NA 4.9 NA NA
TXB055B TXB055 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662930 SAMEA3261934 ERX709177 ERR765904 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 20.9 1.0 0.1 5.6 1.2 19.4
TXB056B TXB056 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662931 SAMEA3261935 ERX709178 ERR765905 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 31.2 1.0 0.1 5.4 1.2 19.4
TXB057B TXB057 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662932 SAMEA3261936 ERX709179 ERR765906 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 31.5 1.0 0.1 5.6 1.2 19.4
TXB058B TXB058 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662933 SAMEA3261937 ERX709180 ERR765907 16S rRNA V1-V3 TCTATACTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 14.9 9.3 0.4 5.3 NA 23.4
TXB059B TXB059 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662934 SAMEA3261938 ERX709181 ERR765908 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 26.5 12.0 0.4 5.5 NA 27.1
TXB060B TXB060 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662935 SAMEA3261939 ERX709182 ERR765909 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 24.8 8.9 0.3 5.1 NA 26.5
TXB061B TXB061 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662936 SAMEA3261940 ERX709183 ERR765910 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 15.2 1.0 0.1 5.0 1.2 19.4
TXB062B TXB062 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662937 SAMEA3261941 ERX709184 ERR765911 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 22.8 1.0 0.1 4.9 1.2 19.4
TXB063B TXB063 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662938 SAMEA3261942 ERX709185 ERR765912 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 10.2 1.0 0.1 4.8 1.2 19.4
TXB064B TXB064 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662939 SAMEA3261943 ERX709186 ERR765913 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 21.5 NA NA 4.4 NA NA
TXB065B TXB065 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662940 SAMEA3261944 ERX709187 ERR765914 16S rRNA V1-V3 TAGTGTAGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 22.8 NA NA 5.0 NA NA
TXB066B TXB066 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662941 SAMEA3261945 ERX709188 ERR765915 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 22.0 NA NA 4.7 NA NA
TXB067B TXB067 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662942 SAMEA3261946 ERX709189 ERR765916 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 18.3 1.0 0.1 4.5 1.3 20.1
TXB068B TXB068 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662943 SAMEA3261947 ERX709190 ERR765917 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 19.8 1.0 0.1 4.4 1.3 20.1
TXB069B TXB069 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662944 SAMEA3261948 ERX709191 ERR765918 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 12 0.98 0.05 4.53 1.3 20.07
TXB070B TXB070 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662945 SAMEA3261949 ERX709192 ERR765919 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 29.1 10.1 0.4 4.3 NA 28.1
TXB071B TXB071 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662946 SAMEA3261950 ERX709193 ERR765920 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 32.9 15.6 0.5 4.5 NA 31.8
TXB072B TXB072 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662947 SAMEA3261951 ERX709194 ERR765921 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 33.6 14.9 0.5 4.6 NA 28.9
TXB073B TXB073 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662948 SAMEA3261952 ERX709195 ERR765922 16S rRNA V1-V3 ATATCGCGAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 17.8 1.0 0.1 5.0 1.3 20.1
TXB074B TXB074 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662949 SAMEA3261953 ERX709196 ERR765923 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 6 0.98 0.05 4.81 1.3 20.07
TXB075B TXB075 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662950 SAMEA3261954 ERX709197 ERR765924 16S rRNA V1-V3 ACTAGCAGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 19.2 1.0 0.1 4.8 1.3 20.1
TXB076B TXB076 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662951 SAMEA3261955 ERX709198 ERR765925 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 25.2 NA NA 4.3 NA NA
TXB077B TXB077 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662952 SAMEA3261956 ERX709199 ERR765926 16S rRNA V1-V3 CGTGTCTCTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 30.2 NA NA 4.4 NA NA
TXB078B TXB078 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662953 SAMEA3261957 ERX709200 ERR765927 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 23.8 NA NA 4.3 NA NA
TXB079B TXB079 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662954 SAMEA3261958 ERX709201 ERR765928 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 16.0 NA NA NA NA NA
TXB080B TXB080 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662955 SAMEA3261959 ERX709202 ERR765929 16S rRNA V1-V3 TACACGTGAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 17.2 NA NA NA NA NA
TXB081B TXB081 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662956 SAMEA3261960 ERX709203 ERR765930 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 18.2 NA NA NA NA NA
TXB082B TXB082 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662957 SAMEA3261961 ERX709204 ERR765931 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 34.6 24.2 0.9 4.5 NA 27.5
TXB083B TXB083 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662958 SAMEA3261962 ERX709205 ERR765932 16S rRNA V1-V3 AGACTATACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 23.2 14.5 0.5 4.4 NA 29.7
TXB084B TXB084 LPTX Texas TXB Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662959 SAMEA3261963 ERX709206 ERR765933 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 22.1 10.4 0.4 4.9 NA 27.7
TXC108B TXC108 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662960 SAMEA3261964 ERX709207 ERR765934 16S rRNA V1-V3 CGTCTAGTAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 23 NA NA 4.79 NA NA
TXC085B TXC085 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662961 SAMEA3261965 ERX709208 ERR765935 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 16 0.88 0.05 4.95 1.29 17.41
TXC086B TXC086 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662962 SAMEA3261966 ERX709209 ERR765936 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 7 0.88 0.05 4.65 1.29 17.41
TXC087B TXC087 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662963 SAMEA3261967 ERX709210 ERR765937 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 5 0.88 0.05 4.96 1.29 17.41
TXC088B TXC088 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662964 SAMEA3261968 ERX709211 ERR765938 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 9 NA NA 5.01 NA NA
TXC089B TXC089 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662965 SAMEA3261969 ERX709212 ERR765939 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 28 NA NA 5.27 NA NA
TXC090B TXC090 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662966 SAMEA3261970 ERX709213 ERR765940 16S rRNA V1-V3 AGCGTCGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 26 NA NA 5.26 NA NA
TXC091B TXC091 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662967 SAMEA3261971 ERX709214 ERR765941 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 20 0.88 0.05 5.24 1.29 17.41
TXC092B TXC092 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662968 SAMEA3261972 ERX709215 ERR765942 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 2 0.88 0.05 4.93 1.29 17.41
TXC093B TXC093 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662969 SAMEA3261973 ERX709216 ERR765943 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 7 0.88 0.05 5.35 1.29 17.41
TXC094B TXC094 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662970 SAMEA3261974 ERX709217 ERR765944 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 3 NA NA 5.04 NA NA
TXC095B TXC095 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662971 SAMEA3261975 ERX709218 ERR765945 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 18 NA NA 4.49 NA NA
TXC096B TXC096 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662972 SAMEA3261976 ERX709219 ERR765946 16S rRNA V1-V3 TCTACGTAGC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 17 NA NA 5.03 NA NA
TXC097B TXC097 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662973 SAMEA3261977 ERX709220 ERR765947 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 16.9 0.9 0.1 5.2 1.3 17.4
TXC098B TXC098 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662974 SAMEA3261978 ERX709221 ERR765948 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 22.4 0.9 0.1 5.4 1.3 17.4
TXC099B TXC099 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662975 SAMEA3261979 ERX709222 ERR765949 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 21.4 0.9 0.1 5.9 1.3 17.4
TXC100B TXC100 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662976 SAMEA3261980 ERX709223 ERR765950 16S rRNA V1-V3 AGCACTGTAG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 12.1 6.5 0.3 4.3 NA 24.4
TXC101B TXC101 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662977 SAMEA3261981 ERX709224 ERR765951 16S rRNA V1-V3 CGACGTGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 10.6 4.7 0.2 4.8 NA 23.7
TXC102B TXC102 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662978 SAMEA3261982 ERX709225 ERR765952 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 19.2 10.8 0.4 4.6 NA 27.2
TXC103B TXC103 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662979 SAMEA3261983 ERX709226 ERR765953 16S rRNA V1-V3 CAGTAGACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 18.1 0.8 0.0 4.4 1.3 15.7
TXC104B TXC104 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662980 SAMEA3261984 ERX709227 ERR765954 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 10.9 0.8 0.0 4.5 1.3 15.7
TXC105B TXC105 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662981 SAMEA3261985 ERX709228 ERR765955 16S rRNA V1-V3 TCGCACTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 11.4 0.8 0.0 4.5 1.3 15.7
TXC106B TXC106 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662982 SAMEA3261986 ERX709229 ERR765956 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 20.8 NA NA 4.6 NA NA
TXC107B TXC107 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662983 SAMEA3261987 ERX709230 ERR765957 16S rRNA V1-V3 TCGATCACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 15.3 NA NA 4.5 NA NA
TXC109B TXC109 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662984 SAMEA3261988 ERX709231 ERR765958 16S rRNA V1-V3 ACTACTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 30.3 0.8 0.0 4.8 1.3 16.3
TXC110B TXC110 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662985 SAMEA3261989 ERX709232 ERR765959 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 11.4 0.8 0.0 4.9 1.3 16.3
TXC111B TXC111 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662986 SAMEA3261990 ERX709233 ERR765960 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 A horizon 12.1 0.8 0.0 5.0 1.3 16.3
TXC112B TXC112 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662987 SAMEA3261991 ERX709234 ERR765961 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 30.1 NA NA 4.5 NA NA
TXC113B TXC113 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662988 SAMEA3261992 ERX709235 ERR765962 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 33.1 NA NA 4.4 NA NA
TXC114B TXC114 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662989 SAMEA3261993 ERX709236 ERR765963 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 0 O horizon 32.2 NA NA 5.3 NA NA
TXC115B TXC115 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662990 SAMEA3261994 ERX709237 ERR765964 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 26.9 0.8 0.0 5.3 1.3 16.3
TXC116B TXC116 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662991 SAMEA3261995 ERX709238 ERR765965 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 A horizon 12.2 0.8 0.0 4.7 1.3 16.3
TXC118B TXC118 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662992 SAMEA3261996 ERX709239 ERR765966 16S rRNA V1-V3 TACACACACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 34.9 NA NA 4.2 NA NA
TXC119B TXC119 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662993 SAMEA3261997 ERX709240 ERR765967 16S rRNA V1-V3 CGAGAGATAC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 26.5 NA NA 4.5 NA NA
TXC120B TXC120 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662994 SAMEA3261998 ERX709241 ERR765968 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM1 C0 1 O horizon 23.9 NA NA 4.3 NA NA
TXC121B TXC121 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662995 SAMEA3261999 ERX709242 ERR765969 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 4 0.69 0.04 4.75 1.36 15.65
TXC122B TXC122 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662996 SAMEA3262000 ERX709243 ERR765970 16S rRNA V1-V3 CACGCTACGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 A horizon 19.4 0.7 0.0 4.7 1.4 15.7
TXC124B TXC124 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662997 SAMEA3262001 ERX709244 ERR765971 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 12.6 NA NA 4.2 NA NA
TXC125B TXC125 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662998 SAMEA3262002 ERX709245 ERR765972 16S rRNA V1-V3 CATAGTAGTG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 12.6 NA NA 4.3 NA NA
TXC126B TXC126 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS662999 SAMEA3262003 ERX709246 ERR765973 16S rRNA V1-V3 ACGCTCGACA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 0 O horizon 14.4 NA NA 5.2 NA NA
TXC127B TXC127 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663000 SAMEA3262004 ERX709247 ERR765974 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 18.9 0.7 0.0 5.0 1.4 15.7
TXC128B TXC128 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663001 SAMEA3262005 ERX709248 ERR765975 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 20.6 0.7 0.0 5.1 1.4 15.7
TXC129B TXC129 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663002 SAMEA3262006 ERX709249 ERR765976 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 A horizon 20.5 0.7 0.0 5.1 1.4 15.7
TXC130B TXC130 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663003 SAMEA3262007 ERX709250 ERR765977 16S rRNA V1-V3 TCTCTATGCG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 15.4 NA NA 4.4 NA NA
TXC131B TXC131 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663004 SAMEA3262008 ERX709251 ERR765978 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 19 NA NA 4.86 NA NA
TXC132B TXC132 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663005 SAMEA3262009 ERX709252 ERR765979 16S rRNA V1-V3 ACTGTACAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM2 C0 1 O horizon 11.7 NA NA 4.1 NA NA
TXC133B TXC133 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663006 SAMEA3262010 ERX709253 ERR765980 16S rRNA V1-V3 TGATACGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 18.9 0.7 0.0 4.3 1.3 16.4
TXC134B TXC134 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663007 SAMEA3262011 ERX709254 ERR765981 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 19.8 0.7 0.0 4.4 1.3 16.4
TXC135B TXC135 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663008 SAMEA3262012 ERX709255 ERR765982 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 A horizon 20.9 0.7 0.0 4.6 1.3 16.4
TXC136B TXC136 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663009 SAMEA3262013 ERX709256 ERR765983 16S rRNA V1-V3 TGACGTATGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 36.3 12.3 0.4 NA NA 27.4
TXC137B TXC137 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663010 SAMEA3262014 ERX709257 ERR765984 16S rRNA V1-V3 TACAGATCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 28.1 9.0 0.3 4.8 NA 27.0
TXC138B TXC138 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663011 SAMEA3262015 ERX709258 ERR765985 16S rRNA V1-V3 TACGCTGTCT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 0 O horizon 33.2 12.3 0.5 4.8 NA 27.2
TXC139B TXC139 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663012 SAMEA3262016 ERX709259 ERR765986 16S rRNA V1-V3 TCACGTACTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 20.3 0.7 0.0 4.4 1.3 16.4
TXC140B TXC140 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663013 SAMEA3262017 ERX709260 ERR765987 16S rRNA V1-V3 ATAGAGTACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 20.5 0.7 0.0 4.5 1.3 16.4
TXC141B TXC141 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663014 SAMEA3262018 ERX709261 ERR765988 16S rRNA V1-V3 ACGCGATCGA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 A horizon 21.2 0.7 0.0 4.9 1.3 16.4
TXC142B TXC142 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663015 SAMEA3262019 ERX709262 ERR765989 16S rRNA V1-V3 CTCGCGTGTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 24.9 NA NA 4.1 NA NA
TXC143B TXC143 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663016 SAMEA3262020 ERX709263 ERR765990 16S rRNA V1-V3 AGACGCACTC AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 25.3 NA NA 4.3 NA NA
TXC144B TXC144 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663017 SAMEA3262021 ERX709264 ERR765991 16S rRNA V1-V3 ATACGACGTA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical OM3 C0 1 O horizon 33.0 NA NA 4.3 NA NA
TXC145B TXC145 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663018 SAMEA3262022 ERX709265 ERR765992 16S rRNA V1-V3 ACAGTATATA AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 17.4 NA NA NA NA NA
TXC146B TXC146 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663019 SAMEA3262023 ERX709266 ERR765993 16S rRNA V1-V3 AGTACGCTAT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 14.3 NA NA NA NA NA
TXC147B TXC147 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663020 SAMEA3262024 ERX709267 ERR765994 16S rRNA V1-V3 TGTGAGTAGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.3 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 A horizon 17.0 NA NA NA NA NA
TXC148B TXC148 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663021 SAMEA3262025 ERX709268 ERR765995 16S rRNA V1-V3 ATCAGACACG AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 41.1 25.1 0.8 4.1 NA 32.3
TXC149B TXC149 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663022 SAMEA3262026 ERX709269 ERR765996 16S rRNA V1-V3 ACGAGTGCGT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 31.2 18.2 0.7 4.7 NA 27.2
TXC150B TXC150 LPTX Texas TXC Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599 ERS663023 SAMEA3262027 ERX709270 ERR765997 16S rRNA V1-V3 TCTAGCGACT AGAGTTTGATCMTGGCTCAG GWATTACCGCGGCKGCTG 2012-03-12 31.11 -95.15 USA 0.1 88 19.0 253 Aquic Glossudalfs Loblolly Pine, Beautyberry, Yaupon, Sweetgum, Oaks, Wax Myrtle Cfa, Humid subtropical REF REF 0 O horizon 36.3 13.8 0.5 4.2 NA 26.8
SL-REF-LFH-1 SL-REF-LFH-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434280 SAMEA4535101 ERX1790570 ERR1720618 16S rRNA V6-V8 CGTCGATCTC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.395 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 LFH NA 14.4 0.4 4.3 NA 27.2
SL-REF-Ahe-1 SL-REF-Ahe-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434281 SAMEA4535102 ERX1790571 ERR1720619 16S rRNA V6-V8 CTACGACTGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.545 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 Ahe NA 1.8 0.1 4.7 NA 26.8
SL-REF-Ae-1 SL-REF-Ae-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434282 SAMEA4535103 ERX1790572 ERR1720620 16S rRNA V6-V8 CTAGTCACTC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.003 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 Ae NA 1.0 0.1 5.4 NA 36.0
SL-REF-AB-1 SL-REF-AB-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434283 SAMEA4535104 ERX1790573 ERR1720621 16S rRNA V6-V8 CTCTACGCTC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.062 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 AB NA 0.7 0.1 5.9 NA 22.5
SL-REF-Bt-1 SL-REF-Bt-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434284 SAMEA4535105 ERX1790574 ERR1720622 16S rRNA V6-V8 TAGCGCGCGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.333 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 Bt NA 0.9 0.1 6.7 NA 19.0
SL-REF-LFH-2 SL-REF-LFH-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434285 SAMEA4535106 ERX1790575 ERR1720623 16S rRNA V6-V8 TAGCTCTATC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.528 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 LFH NA 26.6 0.6 4.5 NA 13.4
SL-REF-Ahe-2 SL-REF-Ahe-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434286 SAMEA4535107 ERX1790576 ERR1720624 16S rRNA V6-V8 TATAGACATC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.002 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 Ahe NA 8.7 0.3 5.1 NA 14.8
SL-REF-Ae-2 SL-REF-Ae-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434287 SAMEA4535108 ERX1790577 ERR1720625 16S rRNA V6-V8 TATGATACGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.067 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 Ae NA 0.7 0.1 6.2 NA 48.4
SL-REF-AB-2 SL-REF-AB-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434288 SAMEA4535109 ERX1790578 ERR1720626 16S rRNA V6-V8 TCACTCATAC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.217 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 AB NA 1.1 0.1 6.3 NA 34.8
SL-REF-Bt-2 SL-REF-Bt-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434289 SAMEA4535110 ERX1790579 ERR1720627 16S rRNA V6-V8 TCATCGAGTC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.597 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 Bt NA 0.7 0.1 6.9 NA 14.6
SL-REF-LFH-3 SL-REF-LFH-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434290 SAMEA4535111 ERX1790580 ERR1720628 16S rRNA V6-V8 TCGAGCTCTC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.002 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 LFH NA 27.5 0.6 5.6 NA 21.2
SL-REF-Ae-3 SL-REF-Ae-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434291 SAMEA4535112 ERX1790581 ERR1720629 16S rRNA V6-V8 TCGCAGACAC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.042 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine Dfc, Boreal cool summer REF C0 0 Ae NA 1.1 0.1 5.7 NA 14.8
SL-REF-AB-3 SL-REF-AB-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434292 SAMEA4535113 ERX1790582 ERR1720630 16S rRNA V6-V8 TCTGTCTCGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.272 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF C0 0 AB NA 0.6 0.1 5.8 NA 45.0
SL-REF-Bt-3 SL-REF-Bt-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434293 SAMEA4535114 ERX1790583 ERR1720631 16S rRNA V6-V8 TGAGTGACGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.492 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer REF C0 0 Bt NA 0.6 0.1 6.6 NA 14.0
SL-OM3-LFH-1 SL-OM3-LFH-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434294 SAMEA4535115 ERX1790584 ERR1720632 16S rRNA V6-V8 AGCGACTAGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.02 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 LFH NA 5.7 0.2 5.9 NA 12.0
SL-OM3-Ae-1 SL-OM3-Ae-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434295 SAMEA4535116 ERX1790585 ERR1720633 16S rRNA V6-V8 AGTAGTGATC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.065 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 Ae NA 0.3 0.0 6.1 NA 12.2
SL-OM3-AB-1 SL-OM3-AB-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434296 SAMEA4535117 ERX1790586 ERR1720634 16S rRNA V6-V8 AGTGTATGTC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.13 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 Bt NA 0.4 0.0 6.5 NA 27.3
SL-OM3-Bt-1 SL-OM3-Bt-1 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434297 SAMEA4535118 ERX1790587 ERR1720635 16S rRNA V6-V8 ATAGATAGAC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.385 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 Bt NA 0.6 0.0 6.9 NA 9.3
SL-OM3-LFH-2 SL-OM3-LFH-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434298 SAMEA4535119 ERX1790588 ERR1720636 16S rRNA V6-V8 ATATAGTCGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.62 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 LFH NA 2.3 0.1 6.2 NA 12.0
SL-OM3-Ae-2 SL-OM3-Ae-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434299 SAMEA4535120 ERX1790589 ERR1720637 16S rRNA V6-V8 ATCTACTGAC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.02 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 Ae NA 1.1 0.1 6.1 NA 14.5
SL-OM3-AB-2 SL-OM3-AB-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434300 SAMEA4535121 ERX1790590 ERR1720638 16S rRNA V6-V8 CACGTAGATC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.075 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 AB NA 0.4 0.0 6.3 NA 22.6
SL-OM3-Bt-2 SL-OM3-Bt-2 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434301 SAMEA4535122 ERX1790591 ERR1720639 16S rRNA V6-V8 CACGTGTCGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.2 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 Bt NA 0.7 0.1 6.8 NA 18.8
SL-OM3-LFH-3 SL-OM3-LFH-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434302 SAMEA4535123 ERX1790592 ERR1720640 16S rRNA V6-V8 CATACTCTAC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.27 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 LFH NA 5.1 0.2 6.0 NA 12.0
SL-OM3-Ae-3 SL-OM3-Ae-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434303 SAMEA4535124 ERX1790593 ERR1720641 16S rRNA V6-V8 CGACACTATC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.555 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 Ae NA 2.1 0.1 5.2 NA 13.0
SL-OM3-AB-3 SL-OM3-AB-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434304 SAMEA4535125 ERX1790594 ERR1720642 16S rRNA V6-V8 CGAGACGCGC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.105 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 AB NA 0.9 0.0 5.7 NA 30.0
SL-OM3-Bt-3 SL-OM3-Bt-3 SBSBC British Columbia SL Forest Soil Whole Community DNA PCR Amplicon pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501 ERS1434305 SAMEA4535126 ERX1790595 ERR1720643 16S rRNA V6-V8 CGTATGCGAC YAAAKGAATTGRCGG ACGGGCGGTGTGTRC 7/15/2007 52.32 -121.92 Canada 0.185 1050 4.1 146–193 Orthic Gray Luvisols Lodgepole pine, Interior spruce Dfc, Boreal cool summer OM3 C0 0 Bt NA 0.6 0.1 6.5 NA 23.3
Open in a new tab

Table 3. Sequencing and sample data for all SIP-hemicellulose and cellulose 16S and ITS amplicon libraries and shotgun metagenomes.

Sample Sample ID Ecozone Region Site Location Environmental Source DNA Source Library Type Common Name Instrument Model Data Repository Study Accession Sample Accession Secondary Sample Accession Experiment Accession Run Accession Target Gene Collection Date Sample weight for DNA extraction (g) Latitude Longitude Country Sampling Depth (m) Elevation (m) Soil Classification Treatment Soil Horizon Replicate Water_content g/g pH Total C (g/kg) Total N (g/kg) Note
A8-OM0C0-M1 A8056 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive PRJEB8420 ERS1420503 SAMEA4521324 ERX1770962 ERR1700674 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM0 A horizon 1 0.26 5.20 2.54 0.11  
A8-OM0C0-M2 A8058 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420504 SAMEA4521325 ERX1770963 ERR1700675 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM0 A horizon 2 0.28 4.90 3.30 0.12  
A8-OM0C0-M3 A8060 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420505 SAMEA4521326 ERX1770964 ERR1700676 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM0 A horizon 3 0.29 5.20 1.69 0.09  
A8-OM0C0-O1 A8055 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420506 SAMEA4521327 ERX1770965 ERR1700677 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM0 O Horizon 1 0.73 4.08 45.78 1.10  
A8-OM0C0-O2 A8057 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420507 SAMEA4521328 ERX1770966 ERR1700678 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM0 O Horizon 2 0.76 4.73 44.34 1.01  
A8-OM0C0-O3 A8059 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420508 SAMEA4521329 ERX1770967 ERR1700679 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM0 O Horizon 3 0.73 4.15 45.67 1.05  
A8-OM1C0-M1 A8032 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420509 SAMEA4521330 ERX1770968 ERR1700680 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM1 A horizon 1 0.23 4.99 3.21 0.13  
A8-OM1C0-M2 A8046 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420510 SAMEA4521331 ERX1770969 ERR1700681 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM1 A horizon 2 0.24 5.15 1.98 0.09  
A8-OM1C0-M3 A8054 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420511 SAMEA4521332 ERX1770970 ERR1700682 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM1 A horizon 3 0.23 5.03 4.66 0.19  
A8-OM1C0-O1 A8031 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420512 SAMEA4521333 ERX1770971 ERR1700683 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM1 O Horizon 1 0.54 4.37 43.17 1.14  
A8-OM1C0-O2 A8045 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420513 SAMEA4521334 ERX1770972 ERR1700684 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM1 O Horizon 2 0.36 4.29 44.40 1.20  
A8-OM1C0-O3 A8053 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420514 SAMEA4521335 ERX1770973 ERR1700685 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM1 O Horizon 3 0.52 4.44 44.31 1.14  
A8-OM2C0-M1 A8038 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420515 SAMEA4521336 ERX1770974 ERR1700686 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM2 A horizon 1 0.19 5.00 1.98 0.09  
A8-OM2C0-M2 A8040 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420516 SAMEA4521337 ERX1770975 ERR1700687 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM2 A horizon 2 0.25 4.92 4.24 0.18  
A8-OM2C0-M3 A8048 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420517 SAMEA4521338 ERX1770976 ERR1700688 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM2 A horizon 3 0.21 5.02 1.84 0.08  
A8-OM2C0-O1 A8037 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420518 SAMEA4521339 ERX1770977 ERR1700689 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM2 O Horizon 1 0.46 4.38 39.33 1.05  
A8-OM2C0-O2 A8039 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420519 SAMEA4521340 ERX1770978 ERR1700690 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM2 O Horizon 2 0.7 4.78 40.33 1.01  
A8-OM2C0-O3 A8047 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420520 SAMEA4521341 ERX1770979 ERR1700691 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0 450 Orthic Dystric Brunisol OM2 O Horizon 3 0.53 4.27 43.54 1.17  
A8-OM3C0-M1 A8036 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420521 SAMEA4521342 ERX1770980 ERR1700692 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM3 A horizon 1 0.14 5.03 1.99 0.09  
A8-OM3C0-M2 A8042 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420522 SAMEA4521343 ERX1770981 ERR1700693 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM3 A horizon 2 0.18 5.27 3.62 0.13  
A8-OM3C0-M3 A8050 BSON Ontario A8 Fensom Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420523 SAMEA4521344 ERX1770982 ERR1700694 WGS 7/4/2011 0.5 49.08 -89.38 Canada 0.2 450 Orthic Dystric Brunisol OM3 A horizon 3 0.21 5.33 1.75 0.08  
BL-OM0C0-M1 BL044 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420524 SAMEA4521345 ERX1770983 ERR1700695 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM0 A horizon 1 0.18 5.48 NA NA  
BL-OM0C0-M2 BL046 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420525 SAMEA4521346 ERX1770984 ERR1700696 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM0 A horizon 2 0.18 5.49 NA NA  
BL-OM0C0-M31 BL048 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420526 SAMEA4521347 ERX1770985 ERR1700697 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM0 A horizon 31 0.15 5.99 NA NA This sample was sequenced twice. This is the first sequence run
BL-OM0C0-M32 BL048 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420527 SAMEA4521348 ERX1770986 ERR1700698 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM0 A horizon 32 0.15 5.99 NA NA This sample was sequenced twice. This is the second sequence run
BL-OM0C0-O1 BL043 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420528 SAMEA4521349 ERX1770987 ERR1700699 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM0 O Horizon 1 0.27 4.51 NA NA  
BL-OM0C0-O2 BL045 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420529 SAMEA4521350 ERX1770988 ERR1700700 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM0 O Horizon 2 0.26 5.28 NA NA  
BL-OM0C0-O3 BL047 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420530 SAMEA4521351 ERX1770989 ERR1700701 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM0 O Horizon 3 0.3 4.9 NA NA  
BL-OM1C0-M1 BL026 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420531 SAMEA4521352 ERX1770990 ERR1700702 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM1 A horizon 1 0.22 5.74 5.486 0.277  
BL-OM1C0-M2 BL028 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420532 SAMEA4521353 ERX1770991 ERR1700703 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM1 A horizon 2 0.21 5.87 5.486 0.277  
BL-OM1C0-M3 BL030 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420533 SAMEA4521354 ERX1770992 ERR1700704 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM1 A horizon 3 0.24 5.89 5.486 0.277  
BL-OM1C0-O1 BL025 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420534 SAMEA4521355 ERX1770993 ERR1700705 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM1 O Horizon 1 0.18 4.79 NA NA  
BL-OM1C0-O2 BL027 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420535 SAMEA4521356 ERX1770994 ERR1700706 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM1 O Horizon 2 0.17 4.9 NA NA  
BL-OM1C0-O3 BL029 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420536 SAMEA4521357 ERX1770995 ERR1700707 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM1 O Horizon 3 0.19 4.69 NA NA  
BL-OM2C0-M1 BL032 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420537 SAMEA4521358 ERX1770996 ERR1700708 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM2 A horizon 1 0.21 5.78 5.238 0.25  
BL-OM2C0-M21 BL034 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420538 SAMEA4521359 ERX1770997 ERR1700709 WGS 9/15/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM2 A horizon 21 0.21 5.3 5.238 0.25 Total C and total N were calculated per plot and not per sample, This sample was sequenced twice. This is the first sequence run
BL-OM2C0-M22 BL034 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420539 SAMEA4521360 ERX1770998 ERR1700710 WGS 9/15/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM2 A horizon 22 0.21 5.3 5.238 0.25 Total C and total N were calculated per plot and not per sample, This sample was sequenced twice. This is the second sequence run
BL-OM2C0-M3 BL036 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420540 SAMEA4521361 ERX1770999 ERR1700711 WGS 9/15/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM2 A horizon 3 0.22 5.72 5.238 0.25 Total C and total N were calculated per plot and not per sample
BL-OM2C0-O1 BL031 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420541 SAMEA4521362 ERX1771000 ERR1700712 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM2 O Horizon 1 0.29 5.73 NA NA  
BL-OM2C0-O2 BL033 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420542 SAMEA4521363 ERX1771001 ERR1700713 WGS 9/16/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM2 O Horizon 2 0.22 5.24 NA NA  
BL-OM2C0-O3 BL035 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420543 SAMEA4521364 ERX1771002 ERR1700714 WGS 9/15/2011 0.5 38.88 -120.64 USA 0 1350 Mesic Ultic Haploxeralfs OM2 O Horizon 3 0.16 5.09 NA NA  
BL-OM3C0-M1 BL038 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420544 SAMEA4521365 ERX1771003 ERR1700715 WGS 9/15/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM3 A horizon 1 0.22 5.42 5.55 0.291  
BL-OM3C0-M2 BL040 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420545 SAMEA4521366 ERX1771004 ERR1700716 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM3 A horizon 2 0.22 5.86 5.55 0.291  
BL-OM3C0-M3 BL042 PPCA California BL Blodgett Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420546 SAMEA4521367 ERX1771005 ERR1700717 WGS 9/16/2011 0.5 38.88 -120.64 USA 0.2 1350 Mesic Ultic Haploxeralfs OM3 A horizon 3 0.21 5.39 5.55 0.291  
JW-OM0C0-M1 JW014 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420547 SAMEA4521368 ERX1771006 ERR1700718 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM0 A horizon 1 0.16 5.48 1.52 0.116  
JW-OM0C0-M2 JW020 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420548 SAMEA4521369 ERX1771007 ERR1700719 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM0 A horizon 2 0.12 5.42 2.556 0.168  
JW-OM0C0-M3 JW026 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420549 SAMEA4521370 ERX1771008 ERR1700720 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM0 A horizon 3 0.14 5.34 3.13 0.221  
JW-OM0C0-O1 JW013 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420550 SAMEA4521371 ERX1771009 ERR1700721 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM0 O Horizon 1 0.31 4.1 38.128 1.066  
JW-OM0C0-O2 JW019 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420551 SAMEA4521372 ERX1771010 ERR1700722 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM0 O Horizon 2 0.31 4.2 36.85 1.199  
JW-OM0C0-O3 JW025 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420552 SAMEA4521373 ERX1771011 ERR1700723 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM0 O Horizon 3 0.4 4.08 34.549 1.139  
JW-OM1C0-M1 JW008 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420553 SAMEA4521374 ERX1771012 ERR1700724 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM1 A horizon 1 0.1 5.24 2.711 0.171  
JW-OM1C0-M2 JW024 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420554 SAMEA4521375 ERX1771013 ERR1700725 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM1 A horizon 2 0.12 5.34 3.13 0.221  
JW-OM1C0-M3 JW030 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420555 SAMEA4521376 ERX1771014 ERR1700726 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM1 A horizon 3 0.14 5.3 3.26 0.293  
JW-OM1C0-O1 JW007 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420556 SAMEA4521377 ERX1771015 ERR1700727 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM1 O Horizon 1 0.4 4.18 36.414 1.114  
JW-OM1C0-O2 JW023 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420557 SAMEA4521378 ERX1771016 ERR1700728 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM1 O Horizon 2 0.47 4.08 34.549 1.139  
JW-OM1C0-O3 JW029 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420558 SAMEA4521379 ERX1771017 ERR1700729 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM1 O Horizon 3 0.57 4.41 33.831 1.027  
JW-OM2C0-M1 JW018 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420559 SAMEA4521380 ERX1771018 ERR1700730 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM2 A horizon 1 0.15 5.42 2.556 0.168  
JW-OM2C0-M2 JW034 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420560 SAMEA4521381 ERX1771019 ERR1700731 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM2 A horizon 2 0.16 5.13 3.029 0.354  
JW-OM2C0-M3 JW038 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420561 SAMEA4521382 ERX1771020 ERR1700732 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM2 A horizon 3 0.13 5.35 2.657 0.476  
JW-OM2C0-O1 JW017 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420562 SAMEA4521383 ERX1771021 ERR1700733 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM2 O Horizon 1 0.47 4.2 36.85 1.199  
JW-OM2C0-O2 JW033 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420563 SAMEA4521384 ERX1771022 ERR1700734 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM2 O Horizon 2 0.6 4 37.617 1.116  
JW-OM2C0-O3 JW037 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420564 SAMEA4521385 ERX1771023 ERR1700735 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0 228 Orthic Humo-Ferric Podzol OM2 O Horizon 3 0.48 4.27 35.24 1.093  
JW-OM3C0-M1 JW004 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420565 SAMEA4521386 ERX1771024 ERR1700736 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM3 A horizon 1 0.11 5.39 2.151 0.122  
JW-OM3C0-M2 JW012 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420566 SAMEA4521387 ERX1771025 ERR1700737 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM3 A horizon 2 0.13 5.48 1.52 0.116  
JW-OM3C0-M3 JW042 JPON Ontario JW Wells Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420567 SAMEA4521388 ERX1771026 ERR1700738 WGS 7/7/2011 0.5 46.42 -83.37 Canada 0.2 228 Orthic Humo-Ferric Podzol OM3 A horizon 3 0.14 5.39 1.284 0.558  
OC-OM0C0-M1 OL364 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656878 SAMEA3235149 ERX697631 ERR753910 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM0 A horizon 1 0.12 4.98 2.33 0.12  
OC-OM0C0-M2 OL365 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656879 SAMEA3235150 ERX697632 ERR753911 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM0 A horizon 2 0.13 5.02 1.23 0.08  
OC-OM0C0-M3 OL366 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656880 SAMEA3235151 ERX697633 ERR753912 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM0 A horizon 3 0.19 5.01 1.96 0.10  
OC-OM0C0-O1 OL361 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656881 SAMEA3235152 ERX697634 ERR753913 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM0 O Horizon 1 0.4 5.04 45.47 1.37  
OC-OM0C0-O2 OL362 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656882 SAMEA3235153 ERX697635 ERR753914 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM0 O Horizon 2 0.46 5.34 45.11 1.47  
OC-OM0C0-O3 OL363 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656883 SAMEA3235154 ERX697636 ERR753915 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM0 O Horizon 3 0.54 4.87 48.55 1.34  
OC-OM1C0-M1 OL370 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656884 SAMEA3235155 ERX697637 ERR753916 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM1 A horizon 1 0.2 5.16 2.51 0.14  
OC-OM1C0-M2 OL371 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656885 SAMEA3235156 ERX697638 ERR753917 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM1 A horizon 2 0.2 5.21 1.78 0.11  
OC-OM1C0-M3 OL372 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656886 SAMEA3235157 ERX697639 ERR753918 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM1 A horizon 3 0.22 5.01 1.79 0.12  
OC-OM1C0-O1 OL367 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656887 SAMEA3235158 ERX697640 ERR753919 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM1 O Horizon 1 0.57 5.36 34.99 1.54  
OC-OM1C0-O2 OL368 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656888 SAMEA3235159 ERX697641 ERR753920 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM1 O Horizon 2 0.57 4.8 37.14 1.36  
OC-OM1C0-O3 OL369 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656889 SAMEA3235160 ERX697642 ERR753921 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM1 O Horizon 3 0.61 5.34 36.59 1.39  
OC-OM2C0-M1 OL376 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656890 SAMEA3235161 ERX697643 ERR753922 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM2 A horizon 1 0.2 5.02 1.73 0.10  
OC-OM2C0-M2 OL377 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656891 SAMEA3235162 ERX697644 ERR753923 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM2 A horizon 2 0.21 5.34 1.82 0.11  
OC-OM2C0-M3 OL378 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656892 SAMEA3235163 ERX697645 ERR753924 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM2 A horizon 3 0.21 5.01 2.00 0.09  
OC-OM2C0-O1 OL373 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656893 SAMEA3235164 ERX697646 ERR753925 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM2 O Horizon 1 0.6 5.07 40.12 1.35  
OC-OM2C0-O2 OL374 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656894 SAMEA3235165 ERX697647 ERR753926 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM2 O Horizon 2 0.59 5.6 35.37 1.56  
OC-OM2C0-O3 OL375 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656895 SAMEA3235166 ERX697648 ERR753927 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0 1075 Brunisolic Gray Luvisol OM2 O Horizon 3 0.6 5.46 25.73 1.10  
OC-OM3C0-M1 OL379 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656896 SAMEA3235167 ERX697649 ERR753928 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM3 A horizon 1 0.23 5.16 1.78 0.10  
OC-OM3C0-M2 OL380 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656897 SAMEA3235168 ERX697650 ERR753929 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM3 A horizon 2 0.21 5.21 1.75 0.11  
OC-OM3C0-M3 OL381 IDFBC British Columbia OC O’Connor Lake Forest Soil Whole Community DNA Shotgun Metagenome 75-bp paired read library Illumina HiSeq 2000 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS656898 SAMEA3235169 ERX697651 ERR753930 WGS 6/18/2011 0.5 50.88 -120.35 Canada 0.2 1075 Brunisolic Gray Luvisol OM3 A horizon 3 0.16 5.27 2.83 0.11  
TXA-OM0C0-M1 TXA037 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420568 SAMEA4521389 ERX1771027 ERR1700739 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM0 A horizon 1 0.1 4.47 NA NA  
TXA-OM0C0-M2 TXA038 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420569 SAMEA4521390 ERX1771028 ERR1700740 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM0 A horizon 2 0.11 4.83 NA NA  
TXA-OM0C0-M3 TXA039 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420570 SAMEA4521391 ERX1771029 ERR1700741 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM0 A horizon 3 0.11 4.39 NA NA  
TXA-OM0C0-O1 TXA040 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420571 SAMEA4521392 ERX1771030 ERR1700742 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM0 O Horizon 1 0.19 4.69 NA NA  
TXA-OM0C0-O2 TXA041 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420572 SAMEA4521393 ERX1771031 ERR1700743 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM0 O Horizon 2 0.34 4.4 NA NA  
TXA-OM0C0-O3 TXA042 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420573 SAMEA4521394 ERX1771032 ERR1700744 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM0 O Horizon 3 0.26 4.25 NA NA  
TXA-OM1C0-M1 TXA001 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420574 SAMEA4521395 ERX1771033 ERR1700745 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM1 A horizon 1 0.12 4.95 1.093 0.05 Total C and total N were calculated per plot and not per sample
TXA-OM1C0-M2 TXA002 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420575 SAMEA4521396 ERX1771034 ERR1700746 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM1 A horizon 2 0.14 4.65 1.093 0.05 Total C and total N were calculated per plot and not per sample
TXA-OM1C0-M3 TXA003 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420576 SAMEA4521397 ERX1771035 ERR1700747 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM1 A horizon 3 0.14 4.56 1.093 0.05 Total C and total N were calculated per plot and not per sample
TXA-OM1C0-O1 TXA004 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420577 SAMEA4521398 ERX1771036 ERR1700748 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM1 O Horizon 1 0.26 4.69 NA NA  
TXA-OM1C0-O2 TXA005 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420578 SAMEA4521399 ERX1771037 ERR1700749 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM1 O Horizon 2 0.28 4.69 NA NA  
TXA-OM1C0-O3 TXA006 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420579 SAMEA4521400 ERX1771038 ERR1700750 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM1 O Horizon 3 0.19 5.04 NA NA  
TXA-OM2C0-M1 TXA013 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420580 SAMEA4521401 ERX1771039 ERR1700751 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM2 A horizon 1 0.11 4.56 1.208 0.047 Total C and total N were calculated per plot and not per sample
TXA-OM2C0-M2 TXA014 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420581 SAMEA4521402 ERX1771040 ERR1700752 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM2 A horizon 2 0.1 5.04 1.208 0.047 Total C and total N were calculated per plot and not per sample
TXA-OM2C0-O1 TXA016 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420582 SAMEA4521403 ERX1771041 ERR1700753 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM2 O Horizon 1 0.15 4.49 NA NA  
TXA-OM2C0-O2 TXA017 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420583 SAMEA4521404 ERX1771042 ERR1700754 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM2 O Horizon 2 0.23 5.74 NA NA  
TXA-OM2C0-O3 TXA018 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420584 SAMEA4521405 ERX1771043 ERR1700755 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM2 O Horizon 3 0.14 5.28 NA NA  
TXA-OM3C0-M1 TXA025 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420585 SAMEA4521406 ERX1771044 ERR1700756 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM3 A horizon 1 0.09 4.58 0.788 0.038 Total C and total N were calculated per plot and not per sample
TXA-OM3C0-M2 TXA026 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420586 SAMEA4521407 ERX1771045 ERR1700757 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM3 A horizon 2 0.09 4.53 0.788 0.038 Total C and total N were calculated per plot and not per sample
TXA-OM3C0-M3 TXA027 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420587 SAMEA4521408 ERX1771046 ERR1700758 WGS 3/12/2012 0.5 31.11 -95.15 USA 0.2 88 Aquic Glossudalfs OM3 A horizon 3 0.09 4.4 0.788 0.038 Total C and total N were calculated per plot and not per sample
TXA-OM3C0-O1 TXA028 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420588 SAMEA4521409 ERX1771047 ERR1700759 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM3 O Horizon 1 0.11 4.68 NA NA  
TXA-OM3C0-O2 TXA029 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420589 SAMEA4521410 ERX1771048 ERR1700760 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM3 O Horizon 2 0.1 4.67 NA NA  
TXA-OM3C0-O3 TXA030 LPTX Texas TXA Kurth Forest Soil Whole Community DNA Shotgun Metagenome 150-bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1420590 SAMEA4521411 ERX1771049 ERR1700761 WGS 3/12/2012 0.5 31.11 -95.15 USA 0 88 Aquic Glossudalfs OM3 O Horizon 3 0.19 4.42 NA NA  
SL-OM3C0-LFH-1 SL-OM3C0-LFH-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458990 SAMEA4559811 ERX1811794 ERR1742252 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.02 1050 Orthic Gray Luvisol OM3 LFH 1 NA 5.87 5.73 0.21  
SL-OM3C0-Ae-1 SL-OM3C0-Ae-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458991 SAMEA4559812 ERX1811795 ERR1742253 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.065 1050 Orthic Gray Luvisol OM3 Ae 1 NA 6.13 0.28 0.03  
SL-OM3C0-AB-1 SL-OM3C0-AB-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458992 SAMEA4559813 ERX1811796 ERR1742254 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.13 1050 Orthic Gray Luvisol OM3 AB 1 NA 6.5 0.36 0.03  
SL-OM3C0-Bt-1 SL-OM3C0-Bt-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458993 SAMEA4559814 ERX1811797 ERR1742255 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.385 1050 Orthic Gray Luvisol OM3 Bt 1 NA 6.9 0.58 0.04  
SL-OM3C0-LFH-2 SL-OM3C0-LFH-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458994 SAMEA4559815 ERX1811798 ERR1742256 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.62 1050 Orthic Gray Luvisol OM3 LFH 2 NA 6.18 2.26 0.1  
SL-OM3C0-Ae-2 SL-OM3C0-Ae-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458995 SAMEA4559816 ERX1811799 ERR1742257 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.02 1050 Orthic Gray Luvisol OM3 Ae 2 NA 6.05 1.13 0.06  
SL-OM3C0-AB-2 SL-OM3C0-AB-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458996 SAMEA4559817 ERX1811800 ERR1742258 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.075 1050 Orthic Gray Luvisol OM3 AB 2 NA 6.27 0.36 0.03  
SL-OM3C0-Bt-2 SL-OM3C0-Bt-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458997 SAMEA4559818 ERX1811801 ERR1742259 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.2 1050 Orthic Gray Luvisol OM3 Bt 2 NA 6.76 0.65 0.05  
SL-OM3C0-LFH-3 SL-OM3C0-LFH-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458998 SAMEA4559819 ERX1811802 ERR1742260 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.27 1050 Orthic Gray Luvisol OM3 LFH 3 NA 6.03 5.1 0.17  
SL-OM3C0-Ae-3 SL-OM3C0-Ae-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1458999 SAMEA4559820 ERX1811803 ERR1742261 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.555 1050 Orthic Gray Luvisol OM3 Ae 3 NA 5.16 2.1 0.09  
SL-OM3C0-AB-3 SL-OM3C0-AB-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459000 SAMEA4559821 ERX1811804 ERR1742262 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.105 1050 Orthic Gray Luvisol OM3 AB 3 NA 5.72 0.88 0.04  
SL-OM3C0-Bt-3 SL-OM3C0-Bt-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459001 SAMEA4559822 ERX1811805 ERR1742263 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.185 1050 Orthic Gray Luvisol OM3 Bt 3 NA 6.45 0.64 0.05  
SL-OM0C0-LFH-1 SL-OM0C0-LFH-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459002 SAMEA4559823 ERX1811806 ERR1742264 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.395 1050 Orthic Gray Luvisol REF LFH 1 NA 4.25 14.4 0.4  
SL-OM0C0-Ahe-1 SL-OM0C0-Ahe-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459003 SAMEA4559824 ERX1811807 ERR1742265 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.545 1050 Orthic Gray Luvisol REF Ahe 1 NA 4.69 1.8 0.08  
SL-OM0C0-Ae-1 SL-OM0C0-Ae-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459004 SAMEA4559825 ERX1811808 ERR1742266 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.003 1050 Orthic Gray Luvisol REF Ae 1 NA 5.42 0.95 0.05  
SL-OM0C0-AB-1 SL-OM0C0-AB-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459005 SAMEA4559826 ERX1811809 ERR1742267 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.062 1050 Orthic Gray Luvisol REF AB 1 NA 5.92 0.67 0.05  
SL-OM0C0-Bt-1 SL-OM0C0-Bt-1 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459006 SAMEA4559827 ERX1811810 ERR1742268 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.333 1050 Orthic Gray Luvisol REF Bt 1 NA 6.72 0.89 0.06  
SL-OM0C0-LFH-2 SL-OM0C0-LFH-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459007 SAMEA4559828 ERX1811811 ERR1742269 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.528 1050 Orthic Gray Luvisol REF LFH 2 NA 4.5 26.64 0.55  
SL-OM0C0-Ahe-2 SL-OM0C0-Ahe-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459008 SAMEA4559829 ERX1811812 ERR1742270 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.002 1050 Orthic Gray Luvisol REF Ahe 2 NA 5.07 8.71 0.25  
SL-OM0C0-Ae-2 SL-OM0C0-Ae-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459009 SAMEA4559830 ERX1811813 ERR1742271 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.067 1050 Orthic Gray Luvisol REF Ae 2 NA 6.22 0.73 0.05  
SL-OM0C0-AB-2 SL-OM0C0-AB-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459010 SAMEA4559831 ERX1811814 ERR1742272 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.217 1050 Orthic Gray Luvisol REF AB 2 NA 6.34 1.06 0.05  
SL-OM0C0-Bt-2 SL-OM0C0-Bt-2 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459011 SAMEA4559832 ERX1811815 ERR1742273 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.597 1050 Orthic Gray Luvisol REF Bt 2 NA 6.9 0.74 0.05  
SL-OM0C0-LFH-3 SL-OM0C0-LFH-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459012 SAMEA4559833 ERX1811816 ERR1742274 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.002 1050 Orthic Gray Luvisol REF LFH 3 NA 5.59 27.46 0.61  
SL-OM0C0-Ae-3 SL-OM0C0-Ae-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459013 SAMEA4559834 ERX1811817 ERR1742275 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.042 1050 Orthic Gray Luvisol REF Ae 3 NA 5.7 1.12 0.08  
SL-OM0C0-AB-3 SL-OM0C0-AB-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459014 SAMEA4559835 ERX1811818 ERR1742276 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.272 1050 Orthic Gray Luvisol REF AB 3 NA 5.77 0.6 0.05  
SL-OM0C0-Bt-3 SL-OM0C0-Bt-3 SBSBC British Columbia SL Skulow Lake Forest Soil Whole Community DNA Shotgun Metagenome 100-bp paired read library Illumina HiSeq X Ten European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420 ERS1459015 SAMEA4559836 ERX1811819 ERR1742277 WGS 7/15/2007 0.5 52.32 -121.92 Canada 0.492 1050 Orthic Gray Luvisol REF Bt 3 NA 6.6 0.61 0.05  
Open in a new tab

Table 4. Sequencing and sample data for all field 16S and ITS amplicon libraries.

SIP Substrate Sample ID SIP Status Sample Alias Ecozone Region Site Environmental Source DNA Source Library Preparation Library Type Common Name Instrument Model Data Repository Study Accession Sample Accession Secondary Sample Accession Experiment Accession Run Accession Target Gene Target Gene Subfragment Barcode Primer Collection Date Sample weight for DNA extraction Latitude Longitude Country Sampling Depth Elevation Mean Annual Temperature (Celsius) Mean Annual Precipitation (mm) Soil Classification Tree Cover Climatic Zone LTSP Treatment Horizon Moisture Content Total Carbon Total Nitrogen pH Soil Bulk Density CN Ratio
Cellulose BL025 12C IIKFCBR01.BL025_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803692 SAMEA3496543 ERX1051796 ERR974810 16S rRNA 27F TGACGTATGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18 NA NA 4.79 NA NA
Cellulose BL026 12C IIKFCBR01.BL026_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803694 SAMEA3496545 ERX1051798 ERR974812 16S rRNA 27F ACTACTATGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 22 5.47 0.28 5.74 NA 19.78
Cellulose BL031 12C IIKFCBR01.BL031_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803696 SAMEA3496547 ERX1051800 ERR974814 16S rRNA 27F ACGCGATCGA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 29 NA NA 5.73 NA NA
Cellulose BL032 12C IIKFCBR01.BL032_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803698 SAMEA3496549 ERX1051802 ERR974816 16S rRNA 27F AGACTATACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 21 5.35 0.26 5.78 NA 20.64
Cellulose BL037 12C IIKFCBR01.BL037_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803700 SAMEA3496551 ERX1051804 ERR974818 16S rRNA 27F AGTATACATA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 21.1 NA NA 5.19 NA NA
Cellulose BL038 12C IIKFCBR01.BL038_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803702 SAMEA3496553 ERX1051806 ERR974820 16S rRNA 27F AGCGTCGTCT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 22 5.27 0.28 5.42 NA 18.87
Cellulose BL043 12C IIKFCBR01.BL043_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803704 SAMEA3496555 ERX1051808 ERR974822 16S rRNA 27F AGTGCTACGA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 27 NA NA 4.51 NA NA
Cellulose BL044 12C IIKFCBR01.BL044_12C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803706 SAMEA3496557 ERX1051810 ERR974824 16S rRNA 27F ATAGAGTACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 18 6.3 0.31 5.48 NA 20.32
Cellulose BR049 12C IIKFCBR01.BR049_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803708 SAMEA3496559 ERX1051812 ERR974826 16S rRNA 27F TACACGTGAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 54 NA NA 5.39 NA NA
Cellulose BR050 12C IIKFCBR01.BR050_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803710 SAMEA3496561 ERX1051814 ERR974828 16S rRNA 27F TGTACTACTC AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 35 6.39 0.25 5.87 NA 25.8
Cellulose BR055 12C IIKFCBR01.BR055_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803712 SAMEA3496563 ERX1051816 ERR974830 16S rRNA 27F TACGCTGTCT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 50 NA NA 5.73 NA NA
Cellulose BR056 12C IIKFCBR01.BR056_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803714 SAMEA3496565 ERX1051818 ERR974832 16S rRNA 27F CGTAGACTAG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 36 5.71 0.28 6.1 NA 20.91
Cellulose BR061 12C IIKFCBR01.BR061_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803716 SAMEA3496567 ERX1051820 ERR974834 16S rRNA 27F TCGATCACGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 40 16.4 0.61 5.81 NA 27.1
Cellulose BR062 12C IIKFCBR01.BR062_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803718 SAMEA3496569 ERX1051822 ERR974836 16S rRNA 27F TACTCTCGTG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 34 5.2 0.27 5.52 NA 19.2
Cellulose BR067 12C IIKFCBR01.BR067_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803720 SAMEA3496571 ERX1051824 ERR974838 16S rRNA 27F TCTAGCGACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 61 NA NA 4.95 NA NA
Cellulose BR068 12C IIKFCBR01.BR068_12C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803722 SAMEA3496573 ERX1051826 ERR974840 16S rRNA 27F TCGTCGCTCG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 28 5.8 0.25 5.95 NA 23.2
Cellulose LH001 12C IIKFCBR01.LH001_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803724 SAMEA3496575 ERX1051828 ERR974842 16S rRNA 27F CGAGAGATAC AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 14 NA NA 3.67 NA NA
Cellulose LH002 12C IIKFCBR01.LH002_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803726 SAMEA3496577 ERX1051830 ERR974844 16S rRNA 27F CTCGCGTGTC AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 19 3.08 0.12 5.18 NA 24.79
Cellulose LH007 12C IIKFCBR01.LH007_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803728 SAMEA3496579 ERX1051832 ERR974846 16S rRNA 27F TCACGTACTA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 10 NA NA 4.58 NA NA
Cellulose LH008 12C IIKFCBR01.LH008_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803730 SAMEA3496581 ERX1051834 ERR974848 16S rRNA 27F TCTCTATGCG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 17.1 3.63 0.16 6 NA 22.3
Cellulose LH013 12C IIKFCBR01.LH013_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803732 SAMEA3496583 ERX1051836 ERR974850 16S rRNA 27F CACGCTACGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 14.1 36.4 1.07 5.08 NA 34.1
Cellulose LH014 12C IIKFCBR01.LH014_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803734 SAMEA3496585 ERX1051838 ERR974852 16S rRNA 27F CGCAGTACGA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 17 3.3 0.15 4.99 NA 21.55
Cellulose LH019 12C IIKFCBR01.LH019_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803736 SAMEA3496587 ERX1051840 ERR974854 16S rRNA 27F CGACGTGACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 22 NA NA 5.57 NA NA
Cellulose LH020 12C IIKFCBR01.LH020_12C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803738 SAMEA3496589 ERX1051842 ERR974856 16S rRNA 27F CGTCTAGTAC AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 20.1 4.14 0.22 6.6 NA 19.14
Cellulose BL025 12C IIKFCBR02.BL025_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803740 SAMEA3496591 ERX1051844 ERR974858 rRNA intergenic spacer analysis ITS2 ACAGTATATA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18 NA NA 4.79 NA NA
Cellulose BL026 12C IIKFCBR02.BL026_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803742 SAMEA3496593 ERX1051846 ERR974860 rRNA intergenic spacer analysis ITS2 TAGAGACGAG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 22 5.47 0.28 5.74 NA 19.78
Cellulose BL031 12C IIKFCBR02.BL031_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803744 SAMEA3496595 ERX1051848 ERR974862 rRNA intergenic spacer analysis ITS2 ACTAGCAGTA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 29 NA NA 5.73 NA NA
Cellulose BL032 12C IIKFCBR02.BL032_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803746 SAMEA3496597 ERX1051850 ERR974864 rRNA intergenic spacer analysis ITS2 ACATACGCGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 21 5.35 0.26 5.78 NA 20.64
Cellulose BL037 12C IIKFCBR02.BL037_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803748 SAMEA3496599 ERX1051852 ERR974866 rRNA intergenic spacer analysis ITS2 AGTATACATA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 21.1 NA NA 5.19 NA NA
Cellulose BL038 12C IIKFCBR02.BL038_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803750 SAMEA3496601 ERX1051854 ERR974868 rRNA intergenic spacer analysis ITS2 ACTGTACAGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 22 5.27 0.28 5.42 NA 18.87
Cellulose BL043 12C IIKFCBR02.BL043_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803752 SAMEA3496603 ERX1051856 ERR974870 rRNA intergenic spacer analysis ITS2 AGTGCTACGA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 27 NA NA 4.51 NA NA
Cellulose BL044 12C IIKFCBR02.BL044_12C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803754 SAMEA3496605 ERX1051858 ERR974872 rRNA intergenic spacer analysis ITS2 AGCGTCGTCT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 18 6.3 0.31 5.48 NA 20.32
Cellulose BR049 12C IIKFCBR02.BR049_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803756 SAMEA3496607 ERX1051860 ERR974874 rRNA intergenic spacer analysis ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 54 NA NA 5.39 NA NA
Cellulose BR050 12C IIKFCBR02.BR050_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803758 SAMEA3496609 ERX1051862 ERR974876 rRNA intergenic spacer analysis ITS2 TCACGTACTA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 35 6.39 0.25 5.87 NA 25.8
Cellulose BR055 12C IIKFCBR02.BR055_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803760 SAMEA3496611 ERX1051864 ERR974878 rRNA intergenic spacer analysis ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 50 NA NA 5.73 NA NA
Cellulose BR056 12C IIKFCBR02.BR056_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803762 SAMEA3496613 ERX1051866 ERR974880 rRNA intergenic spacer analysis ITS2 TCTACGTAGC TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 36 5.71 0.28 6.1 NA 20.91
Cellulose BR061 12C IIKFCBR02.BR061_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803764 SAMEA3496615 ERX1051868 ERR974882 rRNA intergenic spacer analysis ITS2 TCTAGCGACT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 40 16.4 0.61 5.81 NA 27.1
Cellulose BR062 12C IIKFCBR02.BR062_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803766 SAMEA3496617 ERX1051870 ERR974884 rRNA intergenic spacer analysis ITS2 ACGACTACAG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 34 5.2 0.27 5.52 NA 19.2
Cellulose BR067 12C IIKFCBR02.BR067_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803768 SAMEA3496619 ERX1051872 ERR974886 rRNA intergenic spacer analysis ITS2 TGACGTATGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 61 NA NA 4.95 NA NA
Cellulose BR068 12C IIKFCBR02.BR068_12C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803770 SAMEA3496621 ERX1051874 ERR974888 rRNA intergenic spacer analysis ITS2 TACGAGTATG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 28 5.8 0.25 5.95 NA 23.2
Cellulose LH001 12C IIKFCBR02.LH001_12C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803772 SAMEA3496623 ERX1051876 ERR974890 rRNA intergenic spacer analysis ITS2 ATAGAGTACT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 14 NA NA 3.67 NA NA
Cellulose LH002 12C IIKFCBR02.LH002_12C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803774 SAMEA3496625 ERX1051878 ERR974892 rRNA intergenic spacer analysis ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 19 3.08 0.12 5.18 NA 24.79
Cellulose LH007 12C IIKFCBR02.LH007_12C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803776 SAMEA3496627 ERX1051880 ERR974894 rRNA intergenic spacer analysis ITS2 ACGCGAGTAT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 10 NA NA 4.58 NA NA
Cellulose LH008 12C IIKFCBR02.LH008_12C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803778 SAMEA3496629 ERX1051882 ERR974896 rRNA intergenic spacer analysis ITS2 TCTCTATGCG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 17.1 3.63 0.16 6 NA 22.3
Cellulose LH014 12C IIKFCBR02.LH014_12C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803781 SAMEA3496632 ERX1051885 ERR974899 rRNA intergenic spacer analysis ITS2 CGCAGTACGA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 17 3.3 0.15 4.99 NA 21.55
Cellulose LH019 12C IIKFCBR02.LH019_12C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803783 SAMEA3496634 ERX1051887 ERR974901 rRNA intergenic spacer analysis ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 22 NA NA 5.57 NA NA
Cellulose LH020 12C IIKFCBR02.LH020_12C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803785 SAMEA3496636 ERX1051889 ERR974903 rRNA intergenic spacer analysis ITS2 CGAGAGATAC TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 20.1 4.14 0.22 6.6 NA 19.14
Cellulose LH020;BR068;BL044 12C C12_Metagenome_12C PPCA California Pooled Forest Soil Whole Community DNA Nextera Shotgun Metagenome 100 bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS1099581 SAMEA3912447 ERX1413336 ERR1341754 WGS NA TAAGGCGA NA 9/16/2011 0.5 Pooled Pooled USA 0.3 Pooled 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon Pooled Pooled Pooled Pooled Pooled Pooled
Cellulose BL025 13C IIKFCBR01.BL025_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803693 SAMEA3496544 ERX1051797 ERR974811 16S rRNA 27F TCTATACTAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18 NA NA 4.79 NA NA
Cellulose BL026 13C IIKFCBR01.BL026_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803695 SAMEA3496546 ERX1051799 ERR974813 16S rRNA 27F ACATACGCGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 22 5.47 0.28 5.74 NA 19.78
Cellulose BL031 13C IIKFCBR01.BL031_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803697 SAMEA3496548 ERX1051801 ERR974815 16S rRNA 27F ACAGTATATA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 29 NA NA 5.73 NA NA
Cellulose BL032 13C IIKFCBR01.BL032_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803699 SAMEA3496550 ERX1051803 ERR974817 16S rRNA 27F ACTGTACAGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 21 5.35 0.26 5.78 NA 20.64
Cellulose BL037 13C IIKFCBR01.BL037_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803701 SAMEA3496552 ERX1051805 ERR974819 16S rRNA 27F AGCTCACGTA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 21.1 NA NA 5.19 NA NA
Cellulose BL038 13C IIKFCBR01.BL038_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803703 SAMEA3496554 ERX1051807 ERR974821 16S rRNA 27F TGTGAGTAGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 22 5.27 0.28 5.42 NA 18.87
Cellulose BL043 13C IIKFCBR01.BL043_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803705 SAMEA3496556 ERX1051809 ERR974823 16S rRNA 27F AGTCGAGAGA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 27 NA NA 4.51 NA NA
Cellulose BL044 13C IIKFCBR01.BL044_13C.bact PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803707 SAMEA3496558 ERX1051811 ERR974825 16S rRNA 27F AGTACGCTAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 18 6.3 0.31 5.48 NA 20.32
Cellulose BR049 13C IIKFCBR01.BR049_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803709 SAMEA3496560 ERX1051813 ERR974827 16S rRNA 27F TACACACACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 54 NA NA 5.39 NA NA
Cellulose BR050 13C IIKFCBR01.BR050_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803711 SAMEA3496562 ERX1051815 ERR974829 16S rRNA 27F TCTACGTAGC AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 35 6.39 0.25 5.87 NA 25.8
Cellulose BR055 13C IIKFCBR01.BR055_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803713 SAMEA3496564 ERX1051817 ERR974831 16S rRNA 27F TACAGATCGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 50 NA NA 5.73 NA NA
Cellulose BR056 13C IIKFCBR01.BR056_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803715 SAMEA3496566 ERX1051819 ERR974833 16S rRNA 27F ACGACTACAG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 36 5.71 0.28 6.1 NA 20.91
Cellulose BR061 13C IIKFCBR01.BR061_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803717 SAMEA3496568 ERX1051821 ERR974835 16S rRNA 27F TAGTGTAGAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 40 16.4 0.61 5.81 NA 27.1
Cellulose BR062 13C IIKFCBR01.BR062_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803719 SAMEA3496570 ERX1051823 ERR974837 16S rRNA 27F TACGAGTATG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 34 5.2 0.27 5.52 NA 19.2
Cellulose BR067 13C IIKFCBR01.BR067_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803721 SAMEA3496572 ERX1051825 ERR974839 16S rRNA 27F TCGCACTAGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 61 NA NA 4.95 NA NA
Cellulose BR068 13C IIKFCBR01.BR068_13C.bact PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803723 SAMEA3496574 ERX1051827 ERR974841 16S rRNA 27F TAGAGACGAG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 28 5.8 0.25 5.95 NA 23.2
Cellulose LH001 13C IIKFCBR01.LH001_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803725 SAMEA3496576 ERX1051829 ERR974843 16S rRNA 27F ATACGACGTA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 14 NA NA 3.67 NA NA
Cellulose LH002 13C IIKFCBR01.LH002_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803727 SAMEA3496578 ERX1051831 ERR974845 16S rRNA 27F CGTGTCTCTA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 19 3.08 0.12 5.18 NA 24.79
Cellulose LH007 13C IIKFCBR01.LH007_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803729 SAMEA3496580 ERX1051833 ERR974847 16S rRNA 27F ACGCGAGTAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 10 NA NA 4.58 NA NA
Cellulose LH008 13C IIKFCBR01.LH008_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803731 SAMEA3496582 ERX1051835 ERR974849 16S rRNA 27F CGATCGTATA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 17.1 3.63 0.16 6 NA 22.3
Cellulose LH013 13C IIKFCBR01.LH013_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803733 SAMEA3496584 ERX1051837 ERR974851 16S rRNA 27F ACTAGCAGTA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 14.1 36.4 1.07 5.08 NA 34.1
Cellulose LH014 13C IIKFCBR01.LH014_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803735 SAMEA3496586 ERX1051839 ERR974853 16S rRNA 27F TGATACGTCT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 17 3.3 0.15 4.99 NA 21.55
Cellulose LH019 13C IIKFCBR01.LH019_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803737 SAMEA3496588 ERX1051841 ERR974855 16S rRNA 27F CAGTAGACGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 22 NA NA 5.57 NA NA
Cellulose LH020 13C IIKFCBR01.LH020_13C.bact PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803739 SAMEA3496590 ERX1051843 ERR974857 16S rRNA 27F CATAGTAGTG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 20.1 4.14 0.22 6.6 NA 19.14
Cellulose BL025 13C IIKFCBR02.BL025_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803741 SAMEA3496592 ERX1051845 ERR974859 rRNA intergenic spacer analysis ITS2 TGTGAGTAGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18 NA NA 4.79 NA NA
Cellulose BL026 13C IIKFCBR02.BL026_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803743 SAMEA3496594 ERX1051847 ERR974861 rRNA intergenic spacer analysis ITS2 TACTCTCGTG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 22 5.47 0.28 5.74 NA 19.78
Cellulose BL031 13C IIKFCBR02.BL031_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803745 SAMEA3496596 ERX1051849 ERR974863 rRNA intergenic spacer analysis ITS2 ACGCGATCGA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 29 NA NA 5.73 NA NA
Cellulose BL032 13C IIKFCBR02.BL032_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803747 SAMEA3496598 ERX1051851 ERR974865 rRNA intergenic spacer analysis ITS2 TCGTCGCTCG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 21 5.35 0.26 5.78 NA 20.64
Cellulose BL037 13C IIKFCBR02.BL037_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803749 SAMEA3496600 ERX1051853 ERR974867 rRNA intergenic spacer analysis ITS2 AGCTCACGTA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 21.1 NA NA 5.19 NA NA
Cellulose BL038 13C IIKFCBR02.BL038_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803751 SAMEA3496602 ERX1051855 ERR974869 rRNA intergenic spacer analysis ITS2 ACTACTATGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 22 5.27 0.28 5.42 NA 18.87
Cellulose BL043 13C IIKFCBR02.BL043_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803753 SAMEA3496604 ERX1051857 ERR974871 rRNA intergenic spacer analysis ITS2 AGTCGAGAGA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 27 NA NA 4.51 NA NA
Cellulose BL044 13C IIKFCBR02.BL044_13C.fungi PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803755 SAMEA3496606 ERX1051859 ERR974873 rRNA intergenic spacer analysis ITS2 AGACTATACT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 18 6.3 0.31 5.48 NA 20.32
Cellulose BR049 13C IIKFCBR02.BR049_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803757 SAMEA3496608 ERX1051861 ERR974875 rRNA intergenic spacer analysis ITS2 TACAGATCGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 54 NA NA 5.39 NA NA
Cellulose BR050 13C IIKFCBR02.BR050_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803759 SAMEA3496610 ERX1051863 ERR974877 rRNA intergenic spacer analysis ITS2 ATACGACGTA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 35 6.39 0.25 5.87 NA 25.8
Cellulose BR055 13C IIKFCBR02.BR055_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803761 SAMEA3496612 ERX1051865 ERR974879 rRNA intergenic spacer analysis ITS2 TAGTGTAGAT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 50 NA NA 5.73 NA NA
Cellulose BR056 13C IIKFCBR02.BR056_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803763 SAMEA3496614 ERX1051867 ERR974881 rRNA intergenic spacer analysis ITS2 CGTCTAGTAC TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 36 5.71 0.28 6.1 NA 20.91
Cellulose BR061 13C IIKFCBR02.BR061_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803765 SAMEA3496616 ERX1051869 ERR974883 rRNA intergenic spacer analysis ITS2 CGCGTATACA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 40 16.4 0.61 5.81 NA 27.1
Cellulose BR062 13C IIKFCBR02.BR062_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803767 SAMEA3496618 ERX1051871 ERR974885 rRNA intergenic spacer analysis ITS2 TGTACTACTC TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 34 5.2 0.27 5.52 NA 19.2
Cellulose BR067 13C IIKFCBR02.BR067_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803769 SAMEA3496620 ERX1051873 ERR974887 rRNA intergenic spacer analysis ITS2 TCTATACTAT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 61 NA NA 4.95 NA NA
Cellulose BR068 13C IIKFCBR02.BR068_13C.fungi PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803771 SAMEA3496622 ERX1051875 ERR974889 rRNA intergenic spacer analysis ITS2 CGTAGACTAG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 28 5.8 0.25 5.95 NA 23.2
Cellulose LH001 13C IIKFCBR02.LH001_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803773 SAMEA3496624 ERX1051877 ERR974891 rRNA intergenic spacer analysis ITS2 AGTACGCTAT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 14 NA NA 3.67 NA NA
Cellulose LH002 13C IIKFCBR02.LH002_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803775 SAMEA3496626 ERX1051879 ERR974893 rRNA intergenic spacer analysis ITS2 CGTGTCTCTA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 19 3.08 0.12 5.18 NA 24.79
Cellulose LH007 13C IIKFCBR02.LH007_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803777 SAMEA3496628 ERX1051881 ERR974895 rRNA intergenic spacer analysis ITS2 CACGCTACGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 O horizon 10 NA NA 4.58 NA NA
Cellulose LH008 13C IIKFCBR02.LH008_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803779 SAMEA3496630 ERX1051883 ERR974897 rRNA intergenic spacer analysis ITS2 CGATCGTATA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM2 A horizon 17.1 3.63 0.16 6 NA 22.3
Cellulose LH013 13C IIKFCBR02.LH013_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803780 SAMEA3496631 ERX1051884 ERR974898 rRNA intergenic spacer analysis ITS2 CAGTAGACGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 O horizon 14.1 36.4 1.07 5.08 NA 34.09
Cellulose LH014 13C IIKFCBR02.LH014_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803782 SAMEA3496633 ERX1051886 ERR974900 rRNA intergenic spacer analysis ITS2 TGATACGTCT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 17 3.3 0.15 4.99 NA 21.55
Cellulose LH019 13C IIKFCBR02.LH019_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803784 SAMEA3496635 ERX1051888 ERR974902 rRNA intergenic spacer analysis ITS2 TACACACACT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 22 NA NA 5.57 NA NA
Cellulose LH020 13C IIKFCBR02.LH020_13C.fungi PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS803786 SAMEA3496637 ERX1051890 ERR974904 rRNA intergenic spacer analysis ITS2 CATAGTAGTG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 20.1 4.14 0.22 6.6 NA 19.14
Cellulose BL026;BR050;LH002 13C OM1_Metagenome_13C PPCA California Pooled Forest Soil Whole Community DNA Nextera Shotgun Metagenome 100 bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS1099582 SAMEA3912448 ERX1413337 ERR1341755 WGS NA CGTACTAG NA 9/16/2011 0.5 Pooled Pooled USA 0.3 Pooled 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon Pooled Pooled Pooled Pooled Pooled Pooled
Cellulose BL038;BR062;LH014 13C OM3_Metagenome_13C PPCA California Pooled Forest Soil Whole Community DNA Nextera Shotgun Metagenome 100 bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS1099583 SAMEA3912449 ERX1413338 ERR1341756 WGS NA AGGCAGAA NA 9/16/2011 0.5 Pooled Pooled USA 0.3 Pooled 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon Pooled Pooled Pooled Pooled Pooled Pooled
Cellulose LH020;BR068;BL044 13C REF_Metagenome_13C PPCA California Pooled Forest Soil Whole Community DNA Nextera Shotgun Metagenome 100 bp paired read library Illumina HiSeq 2500 European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761 ERS1099584 SAMEA3912450 ERX1413339 ERR1341757 WGS NA TCCTGAGC NA 9/16/2011 0.5 Pooled Pooled USA 0.3 Pooled 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon Pooled Pooled Pooled Pooled Pooled Pooled
Hemicellulose BP479 12C 12C-OM1-Organic-BP-C1-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713515 SAMEA3360063 ERX945177 ERR865549 16S rRNA 27F TACAGATCGT AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 O horizon 63.7 38.66 1.10 5.60 NA 35.84
Hemicellulose BP482 12C 12C-OM1-Mineral-BP-C2-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713517 SAMEA3360065 ERX945174 ERR865546 16S rRNA 27F TGATACGTCT AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 A horizon 25.5 2.98 0.11 5.35 NA 27.44
Hemicellulose BP515 12C 12C-OM0-Organic-BP-C3-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713519 SAMEA3360067 ERX945171 ERR865543 16S rRNA 27F CATAGTAGTG AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF O horizon 61.0 44.38 1.25 5.35 NA 37.11
Hemicellulose BP518 12C 12C-OM0-Mineral-BP-C4-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713521 SAMEA3360069 ERX945169 ERR865541 16S rRNA 27F ATACGACGTA AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF A horizon 19.0 2.42 0.10 5.58 NA 23.78
Hemicellulose DC578 12C 12C-OM0-Mineral-DC-C4-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713526 SAMEA3360074 ERX945170 ERR865542 16S rRNA 27F ATAGAGTACT AGAGTTTGATCMTGGCTCAG 6/25/2010 0.5 50.85 -120.42 CANADA 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF A horizon 19.0 2.34 0.10 5.17 NA 23.60
Hemicellulose OC407 12C 12C-OM1-Organic-OC-C1-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713508 SAMEA3360056 ERX945178 ERR865550 16S rRNA 27F ACGAGTGCGT AGAGTTTGATCMTGGCTCAG 6/26/2010 0.5 50.88 -120.35 CANADA 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 O horizon 50.0 33.83 1.41 5.50 NA 24.05
Hemicellulose OC410 12C 12C-OM1-Mineral-OC-C2-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713510 SAMEA3360058 ERX945175 ERR865547 16S rRNA 27F AGACGCACTC AGAGTTTGATCMTGGCTCAG 6/26/2010 0.5 50.88 -120.35 CANADA 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 A horizon 23.0 1.79 0.11 5.62 NA 15.92
Hemicellulose OC455 12C 12C-OM0-Organic-OC-C3-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713512 SAMEA3360060 ERX945172 ERR865544 16S rRNA 27F ATCAGACACG AGAGTTTGATCMTGGCTCAG 6/26/2010 0.5 50.88 -120.35 CANADA 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF O horizon 37.0 44.18 1.39 5.41 NA 31.71
Hemicellulose BP479 13C 13C-OM1-Organic-BP-C1-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713516 SAMEA3360064 ERX945191 ERR865563 16S rRNA 27F TCTCTATGCG AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 O horizon 63.7 38.66 1.10 5.60 NA 35.84
Hemicellulose BP482 13C 13C-OM1-Mineral-BP-C2-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713518 SAMEA3360066 ERX945186 ERR865558 16S rRNA 27F ACTAGCAGTA AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 A horizon 25.5 2.98 0.11 5.35 NA 27.44
Hemicellulose BP515 13C 13C-OM0-Organic-BP-C3-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713520 SAMEA3360068 ERX945182 ERR865554 16S rRNA 27F CGAGAGATAC AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF O horizon 61.0 44.38 1.25 5.35 NA 37.11
Hemicellulose BP515 13C 13C-OM0-Organic-BP-C3-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive PRJEB9182 ERS713540 SAMEA3360088 ERX945201 ERR865573 rRNA intergenic spacer analysis ITS2 CGTACAGTCA TCCTCCGCTTATTGATATGC 6/22/2010 0.5 50.93 -120.28 CANADA 0.1 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF O horizon 61.0 44.38 1.25 5.35 NA 37.11
Hemicellulose BP518 13C 13C-OM0-Mineral-BP-C4-1 IDFBC British Columbia BP Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713522 SAMEA3360070 ERX945179 ERR865551 16S rRNA 27F TCACGTACTA AGAGTTTGATCMTGGCTCAG 6/22/2010 0.5 50.93 -120.28 CANADA 0.3 1180 2.5 300 Brunisolic Gray Luvisol Douglas fir, Lodgepole pine Dfb, Humid Continental warm summer REF A horizon 19.0 2.42 0.10 5.58 NA 23.78
Hemicellulose DC545 13C 13C-OM1-Organic-DC-C1-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713523 SAMEA3360071 ERX945192 ERR865564 16S rRNA 27F TCTACGTAGC AGAGTTTGATCMTGGCTCAG 6/25/2010 0.5 50.85 -120.42 CANADA 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 O horizon 57.7 38.70 1.31 5.57 NA 30.04
Hemicellulose DC545 13C 13C-OM1-Organic-DC-C1-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713550 SAMEA3360098 ERX945211 ERR865583 rRNA intergenic spacer analysis ITS2 TACGTCATCA TCCTCCGCTTATTGATATGC 6/25/2010 0.5 50.85 -120.42 CANADA 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 O horizon 57.7 38.70 1.31 5.57 NA 30.04
Hemicellulose DC548 13C 13C-OM1-Mineral-DC-C2-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713524 SAMEA3360072 ERX945187 ERR865559 16S rRNA 27F AGACTATACT AGAGTTTGATCMTGGCTCAG 6/25/2010 0.5 50.85 -120.42 CANADA 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer OM1 A horizon 27.7 2.25 0.11 5.16 NA 20.61
Hemicellulose DC575 13C 13C-OM0-Organic-DC-C3-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713525 SAMEA3360073 ERX945183 ERR865555 16S rRNA 27F AGTACGCTAT AGAGTTTGATCMTGGCTCAG 6/25/2010 0.5 50.85 -120.42 CANADA 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF O horizon 58.3 44.30 1.07 5.00 NA 41.53
Hemicellulose DC575 13C 13C-OM0-Organic-DC-C3-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713542 SAMEA3360090 ERX945203 ERR865575 rRNA intergenic spacer analysis ITS2 TCACGCGAGA TCCTCCGCTTATTGATATGC 6/25/2010 0.5 50.85 -120.42 CANADA 0.1 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF O horizon 58.3 44.30 1.07 5.00 NA 41.53
Hemicellulose DC578 13C 13C-OM0-Mineral-DC-C4-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713527 SAMEA3360075 ERX945180 ERR865552 16S rRNA 27F CACGCTACGT AGAGTTTGATCMTGGCTCAG 6/25/2010 0.5 50.85 -120.42 CANADA 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF A horizon 19.0 2.34 0.10 5.17 NA 23.60
Hemicellulose DC578 13C 13C-OM0-Mineral-DC-C4-1 IDFBC British Columbia DC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713535 SAMEA3360083 ERX945196 ERR865568 rRNA intergenic spacer analysis ITS2 TCGCTGCGTA TCCTCCGCTTATTGATATGC 6/25/2010 0.5 50.85 -120.42 CANADA 0.3 1150 2.5 300 Brunisolic Gray Luvisol Douglas fir, Subalpine fir, Lodgepole pine Dfb, Humid Continental warm summer REF A horizon 19.0 2.34 0.10 5.17 NA 23.60
Hemicellulose OC407 13C 13C-OM1-Organic-OC-C1-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713509 SAMEA3360057 ERX945193 ERR865565 16S rRNA 27F ACGCTCGACA AGAGTTTGATCMTGGCTCAG 6/26/2010 0.5 50.88 -120.35 CANADA 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 O horizon 50.0 33.83 1.41 5.50 NA 24.05
Hemicellulose OC407 13C 13C-OM1-Organic-OC-C1-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713552 SAMEA3360100 ERX945213 ERR865585 rRNA intergenic spacer analysis ITS2 TGACGTATGT TCCTCCGCTTATTGATATGC 6/26/2010 0.5 50.88 -120.35 CANADA 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 O horizon 50.0 33.83 1.41 5.50 NA 24.05
Hemicellulose OC410 13C 13C-OM1-Mineral-OC-C2-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713511 SAMEA3360059 ERX945188 ERR865560 16S rRNA 27F AGCACTGTAG AGAGTTTGATCMTGGCTCAG 6/26/2010 0.5 50.88 -120.35 CANADA 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 A horizon 23.0 1.79 0.11 5.62 NA 15.92
Hemicellulose OC410 13C 13C-OM1-Mineral-OC-C2-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713546 SAMEA3360094 ERX945207 ERR865579 rRNA intergenic spacer analysis ITS2 ACAGTATATA TCCTCCGCTTATTGATATGC 6/26/2010 0.5 50.88 -120.35 CANADA 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer OM1 A horizon 23.0 1.79 0.11 5.62 NA 15.92
Hemicellulose OC455 13C 13C-OM0-Organic-OC-C3-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713513 SAMEA3360061 ERX945184 ERR865556 16S rRNA 27F ATATCGCGAG AGAGTTTGATCMTGGCTCAG 6/26/2010 0.5 50.88 -120.35 CANADA 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF O horizon 37.0 44.18 1.39 5.41 NA 31.71
Hemicellulose OC455 13C 13C-OM0-Organic-OC-C3-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713543 SAMEA3360091 ERX945204 ERR865576 rRNA intergenic spacer analysis ITS2 ACTAGCAGTA TCCTCCGCTTATTGATATGC 6/26/2010 0.5 50.88 -120.35 CANADA 0.1 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF O horizon 37.0 44.18 1.39 5.41 NA 31.71
Hemicellulose OC458 13C 13C-OM0-Mineral-OC-C4-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713514 SAMEA3360062 ERX945181 ERR865553 16S rRNA 27F CTCGCGTGTC AGAGTTTGATCMTGGCTCAG 6/26/2010 0.5 50.88 -120.35 CANADA 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF A horizon 13.0 1.81 0.10 5.68 NA 18.68
Hemicellulose OC458 13C 13C-OM0-Mineral-OC-C4-1 IDFBC British Columbia OC Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713536 SAMEA3360084 ERX945197 ERR865569 rRNA intergenic spacer analysis ITS2 AGTATACATA TCCTCCGCTTATTGATATGC 6/26/2010 0.5 50.88 -120.35 CANADA 0.3 1075 2.5 300 Brunisolic Gray Luvisol Douglas fir Dfb, Humid Continental warm summer REF A horizon 13.0 1.81 0.10 5.68 NA 18.68
Hemicellulose BL029 12C 12C-OM1-Organic-BL-029-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713528 SAMEA3360076 ERX945176 ERR865548 16S rRNA 27F ACGCGAGTAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18.9 NA NA 4.69 NA NA
Hemicellulose BL029 12C 12C-OM1-Organic-BL-029-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713534 SAMEA3360082 ERX945195 ERR865567 rRNA intergenic spacer analysis ITS2 TCTGACGTCA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18.9 NA NA 4.69 NA NA
Hemicellulose BL030 12C 12C-OM1-Mineral-BL-030-2 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713483 SAMEA3360031 ERX945146 ERR865518 16S rRNA 27F CACGCTACGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 23.7 5.47 0.28 5.89 NA 19.78
Hemicellulose BL030 12C 12C-OM1-Mineral-BL-030-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713531 SAMEA3360079 ERX945173 ERR865545 16S rRNA 27F TACACACACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 23.7 5.47 0.28 5.89 NA 19.78
Hemicellulose BL030 12C 12C-OM1-Mineral-BL-030-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713533 SAMEA3360081 ERX945194 ERR865566 rRNA intergenic spacer analysis ITS2 TGTCGTCGCA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 23.7 5.47 0.28 5.89 NA 19.78
Hemicellulose BL045 12C 12C-OM0-Organic-BL-045-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713504 SAMEA3360052 ERX945145 ERR865517 16S rRNA 27F TCTAGCGACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 25.8 NA NA 5.28 NA NA
Hemicellulose BL046 12C 12C-OM0-Mineral-BL-046-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713493 SAMEA3360041 ERX945144 ERR865516 16S rRNA 27F TACAGATCGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 17.5 6.30 0.31 5.49 NA 20.32
Hemicellulose BR049 12C 12C-OM1-Organic-BR-C2-1 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713486 SAMEA3360034 ERX945147 ERR865519 16S rRNA 27F AGACTATACT AGAGTTTGATCMTGGCTCAG 6/22/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 54.2 41.60 1.63 5.39 NA 25.48
Hemicellulose LH001 12C 12C-OM1-Organic-LH-C1-1 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713499 SAMEA3360047 ERX945148 ERR865520 16S rRNA 27F CAGTAGACGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 14.4 44.78 1.01 3.67 NA 44.36
Hemicellulose BL026 13C 13C-OM1-Mineral-BL-026-2 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713496 SAMEA3360044 ERX945159 ERR865531 16S rRNA 27F CGAGAGATAC AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 22.0 5.47 0.28 5.74 NA 19.78
Hemicellulose BL027 13C 13C-OM1-Organic-BL-027-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713530 SAMEA3360078 ERX945189 ERR865561 16S rRNA 27F CGACGTGACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 16.7 NA NA 4.90 NA NA
Hemicellulose BL027 13C 13C-OM1-Organic-BL-027-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713547 SAMEA3360095 ERX945208 ERR865580 rRNA intergenic spacer analysis ITS2 TGTCACACGA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 16.7 NA NA 4.90 NA NA
Hemicellulose BL028 13C 13C-OM1-Mineral-BL-028-2 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713497 SAMEA3360045 ERX945160 ERR865532 16S rRNA 27F TCACGTACTA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 21.0 5.47 0.28 5.87 NA 19.78
Hemicellulose BL029 13C 13C-OM1-Organic-BL-029-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713529 SAMEA3360077 ERX945190 ERR865562 16S rRNA 27F ACTACTATGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18.9 NA NA 4.69 NA NA
Hemicellulose BL029 13C 13C-OM1-Organic-BL-029-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713548 SAMEA3360096 ERX945209 ERR865581 rRNA intergenic spacer analysis ITS2 TGAGTCAGTA TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 18.9 NA NA 4.69 NA NA
Hemicellulose BL030 13C 13C-OM1-Mineral-BL-030-2 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713484 SAMEA3360032 ERX945161 ERR865533 16S rRNA 27F ATAGAGTACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 23.7 5.47 0.28 5.89 NA 19.78
Hemicellulose BL030 13C 13C-OM1-Mineral-BL-030-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713532 SAMEA3360080 ERX945185 ERR865557 16S rRNA 27F TACACGTGAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 23.7 5.47 0.28 5.89 NA 19.78
Hemicellulose BL030 13C 13C-OM1-Mineral-BL-030-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713544 SAMEA3360092 ERX945205 ERR865577 rRNA intergenic spacer analysis ITS2 ACACATACGC TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 23.7 5.47 0.28 5.89 NA 19.78
Hemicellulose BL030 13C 13C-OM1-Mineral-BL-030-2 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713545 SAMEA3360093 ERX945206 ERR865578 rRNA intergenic spacer analysis ITS2 TACTCTCGTG TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 23.7 5.47 0.28 5.89 NA 19.78
Hemicellulose BL038 13C 13C-OM3-Mineral-BL-038-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713489 SAMEA3360037 ERX945166 ERR865538 16S rRNA 27F ACGCTCGACA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 21.7 5.27 0.28 5.42 NA 18.87
Hemicellulose BL040 13C 13C-OM3-Mineral-BL-040-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713490 SAMEA3360038 ERX945167 ERR865539 16S rRNA 27F AGCACTGTAG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 22.2 5.27 0.28 5.86 NA 18.87
Hemicellulose BL042 13C 13C-OM3-Mineral-BL-042-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713491 SAMEA3360039 ERX945168 ERR865540 16S rRNA 27F ATATCGCGAG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM3 A horizon 21.5 5.27 0.28 5.39 NA 18.87
Hemicellulose BL044 13C 13C-OM0-Mineral-BL-044-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713492 SAMEA3360040 ERX945149 ERR865521 16S rRNA 27F CTCGCGTGTC AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 17.8 6.30 0.31 5.48 NA 20.32
Hemicellulose BL045 13C 13C-OM0-Organic-BL-045-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713505 SAMEA3360053 ERX945154 ERR865526 16S rRNA 27F TCTATACTAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 25.8 NA NA 5.28 NA NA
Hemicellulose BL045 13C 13C-OM0-Organic-BL-045-2 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713506 SAMEA3360054 ERX945155 ERR865527 16S rRNA 27F TGTGAGTAGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 25.8 NA NA 5.28 NA NA
Hemicellulose BL045 13C 13C-OM0-Organic-BL-045-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713537 SAMEA3360085 ERX945198 ERR865570 rRNA intergenic spacer analysis ITS2 TACACGTGAT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 25.8 NA NA 5.28 NA NA
Hemicellulose BL045 13C 13C-OM0-Organic-BL-045-2 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713538 SAMEA3360086 ERX945199 ERR865571 rRNA intergenic spacer analysis ITS2 TACGCTGTCT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 25.8 NA NA 5.28 NA NA
Hemicellulose BL046 13C 13C-OM0-Mineral-BL-046-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713494 SAMEA3360042 ERX945150 ERR865522 16S rRNA 27F TCTCTATGCG AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 17.5 6.30 0.31 5.49 NA 20.32
Hemicellulose BL047 13C 13C-OM0-Organic-BL-047-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713507 SAMEA3360055 ERX945156 ERR865528 16S rRNA 27F ACGCGATCGA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 29.8 NA NA 4.90 NA NA
Hemicellulose BL047 13C 13C-OM0-Organic-BL-047-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713539 SAMEA3360087 ERX945200 ERR865572 rRNA intergenic spacer analysis ITS2 TCGATCACGT TCCTCCGCTTATTGATATGC 9/16/2011 0.5 38.88 -120.64 USA 0.1 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 29.8 NA NA 4.90 NA NA
Hemicellulose BL048 13C 13C-OM0-Mineral-BL-048-1 PPCA California BL Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713495 SAMEA3360043 ERX945151 ERR865523 16S rRNA 27F ACTAGCAGTA AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 38.88 -120.64 USA 0.3 1350 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 15.3 6.30 0.31 5.99 NA 20.32
Hemicellulose BR049 13C 13C-OM1-Organic-BR-C2-1 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713487 SAMEA3360035 ERX945164 ERR865536 16S rRNA 27F ACTGTACAGT AGAGTTTGATCMTGGCTCAG 6/22/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 54.2 41.60 1.63 5.39 NA 25.48
Hemicellulose BR049 13C 13C-OM1-Organic-BR-C2-1 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713549 SAMEA3360097 ERX945210 ERR865582 rRNA intergenic spacer analysis ITS2 TGTACTACTC TCCTCCGCTTATTGATATGC 6/22/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 54.2 41.60 1.63 5.39 NA 25.48
Hemicellulose BR050 13C 13C-OM1-Mineral-BR-C1-1 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713485 SAMEA3360033 ERX945162 ERR865534 16S rRNA 27F AGCGTCGTCT AGAGTTTGATCMTGGCTCAG 6/22/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 35.0 8.54 0.34 5.87 NA 25.34
Hemicellulose BR067 13C 13C-OM0-Organic-BR-C4-1 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713498 SAMEA3360046 ERX945157 ERR865529 16S rRNA 27F ACTACTATGT AGAGTTTGATCMTGGCTCAG 6/22/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 60.7 39.24 1.24 4.95 NA 31.64
Hemicellulose BR067 13C 13C-OM0-Organic-BR-C4-1 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713541 SAMEA3360089 ERX945202 ERR865574 rRNA intergenic spacer analysis ITS2 ACATACGCGT TCCTCCGCTTATTGATATGC 6/22/2011 0.5 39.55 -121.04 USA 0.1 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 60.7 39.24 1.24 4.95 NA 31.64
Hemicellulose BR068 13C 13C-OM0-Mineral-BR-C3-1 PPCA California BR Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713488 SAMEA3360036 ERX945152 ERR865524 16S rRNA 27F CGTCTAGTAC AGAGTTTGATCMTGGCTCAG 6/22/2011 0.5 39.55 -121.04 USA 0.3 1135 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 27.5 6.74 0.29 5.95 NA 23.37
Hemicellulose LH001 13C 13C-OM1-Organic-LH-C1-1 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713500 SAMEA3360048 ERX945165 ERR865537 16S rRNA 27F CGACGTGACT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 14.4 44.78 1.01 3.67 NA 44.36
Hemicellulose LH001 13C 13C-OM1-Organic-LH-C1-1 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182 ERS713551 SAMEA3360099 ERX945212 ERR865584 rRNA intergenic spacer analysis ITS2 CTCGCGTGTC TCCTCCGCTTATTGATATGC 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 O horizon 14.4 44.78 1.01 3.67 NA 44.36
Hemicellulose LH002 13C 13C-OM1-Mineral-LH-C2-1 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713501 SAMEA3360049 ERX945163 ERR865535 16S rRNA 27F TACACGTGAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer OM1 A horizon 18.5 4.78 0.16 5.18 NA 29.59
Hemicellulose LH019 13C 13C-OM0-Organic-LH-C3-1 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713502 SAMEA3360050 ERX945158 ERR865530 16S rRNA 27F TAGTGTAGAT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.1 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF O horizon 21.7 39.67 1.28 5.57 NA 30.95
Hemicellulose LH020 13C 13C-OM0-Mineral-LH-C4-1 PPCA California LH Forest Soil Whole Community DNA PCR Amplicon Pyrotag library 454 GS FLX Titanium European Nucleotide Archive https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181 ERS713503 SAMEA3360051 ERX945153 ERR865525 16S rRNA 27F TCGCACTAGT AGAGTTTGATCMTGGCTCAG 9/16/2011 0.5 39.26 -120.78 USA 0.3 1268 11.2 55 Mesic Ultic Haploxeralfs Ponderosa pine, sugar pine, white fir, giant sequoia Csa, Mediterranean hot summer REF A horizon 20.1 4.14 0.22 6.60 NA 19.14
Open in a new tab

Here, we provide an overview of the data collection, without detailed analysis of results or discussion, to draw attention to its unparalleled comprehensive and multi-faceted view into forest soil microbial communities. The collection is the first high-throughput sequencing-based survey of LTSP sites, and, as such, provides base-line data for future LTSP investigations at an important, stage of forest regeneration just prior to canopy closure. Researchers can revisit this collection as our understanding of the ecology of forest soils advances. This will be important given the substantial proportion of unknown taxa in these collections affected by timber harvesting9. SIP data offers unique insights into the effects of timber harvesting on decomposer populations, including detailed information on uncultured taxa provided by the ten partial genomes recovered from SIP-cellulose shotgun metagenomes (Data Citation 6). The consistency in experimental design, sequencing methodology and sample sources ensures the value of this collection for on-going studies of forest soil microbial communities, in particular those pertaining to biogeography, soil strata and forest disturbance.

Methods

Experimental design

Soil samples were collected from reforested experimental plots within the Long-Term Soil Productivity (LTSP) Study from eighteen different sites across six conifer-dominated North American ecozones named after the predominant tree species (Fig. 1; Table 1): IDFBC (interior Douglas-fir), SBSBC (sub-boreal spruce), PPCA (ponderosa pine), BSON (black spruce), JPON (jack pine) and LPTX (loblolly pine). Ecozones were chosen to exemplify a broad range of climates and regions in North America where forestry is a major industry. These differed by several factors, including soil type, mean annual temperature and precipitation, tree species and bulk soil chemistry, such as carbon and nitrogen content and pH (Table 1). Each ecozone contained three sites with four treatments: REF (or OM0), a neighbouring unharvested reference plot; and three harvested treatments: OM1, where only tree boles (stems) were removed and woody debris was left in place; OM2, where whole trees including branches were removed and; OM3, where whole trees were removed and the upper organic layer of forest floor scraped away (Fig. 2). Compaction was controlled and, in all cases, plots with minimum compaction (‘C0’) were sampled. Moderate (C1) and severe (C2) compaction treatments were included in 16S rRNA gene and ITS pyrotag libraries in SBSBC and IDFBC (Table 2 (available online only)). Similarly, additional amplicon libraries were prepared from soils in JPON and LPTX which had been exposed to glyphosate (Table 2 (available online only)). Samples were collected from triplicate plots at each of the three sites in BSON and JPON, while at sites in the other four ecozones triplicate samples were collected from a single, larger plot. Each sample corresponds to a composite from between three to five sampling points (consistent within a given ecozone) in a plot which helped account for soil heterogeneity. Organic layer samples (O-horizons) were first sampled with a trowel and then the top 20 cm of mineral layer soil (A and upper B-horizon) were collected using a Stoney auger (5 cm diameter). For several 16S rRNA gene amplicon and whole shotgun sequencing libraries from Skulow Lake (denoted in Tables 2 and 3 (available online only)), samples were collected from five soil horizons: LFH and mineral horizons (Ahe, Ae, AB and Bt), distinguished using criteria from the Canadian System of Soil Classification. Samples were stored at 4 °C during transport and until each sample was sieved through 2-mm mesh to remove roots, then stored at −80 °C until DNA was extracted within three months of sampling. Soil samples used in metatranscriptomics were flash frozen in liquid nitrogen, transported on dry ice and subsequently stored at −80 °C until DNA and RNA was extracted within 12 months of sampling.

Figure 2. Plot conditions immediately following harvesting (year zero) in the PPCA ecozone.

Figure 2

Open in a new tab

These photographs capture the initial variation in the amount of organic matter (OM) removal at plots which were sampled 11–17 years for this study. Plots like these were replicated at three sites within every ecozone [photo credit: Dr Matt Busse; mbusse@fs.fed.us

Amplicon and shotgun metagenome sequencing

DNA was extracted from field samples (0.5 g of soil) using the manufacturer’s recommended protocol for the FastDNA Spin Kit for Soil (MPBio, Santa Ana, CA). Amplicon libraries were prepared for the 16S rRNA gene (V1-V3 regions) and fungal internal transcribed spacer region (ITS2) according to the procedure of Hartmann et al.5. The region spanning V1–V3 was amplified using barcoded universal primers: 27F (5′- AGA GTT TGA TCM TGG CTC AG–3′) and 519R (5′- GWA TTA CCG CGG CKG CTG–3′)11,12 and the fungal internal transcribed spacer (ITS2) region was amplified using barcoded primers: ITS3 (5′- GCA TCG ATG AAG AAC GCA GC–3′) and ITS4 (5′- TCC TCC GCT TAT TGA TAT GC–3′)13. Amplicons were generated via polymerase chain reaction (PCR) in triplicate for each sample and pooled prior to purification and quantification. DNA quantitation was performed using Pico-Green fluorescent dye (ThermoFisher, MA, USA). Samples were sequenced using the Roche 454 Titanium platform at the McGill University and at the Genome Québec Innovation Centre with a maximum of 40 samples multiplexed on each quarter plate. Table 2 (available online only) contains information on all amplicon libraries created from field soil samples, including 16S rRNA gene amplicon (Data Citation 1) and ITS amplicon libraries (Data Citation 2). This includes a second set of samples from Skulow Lake with a narrower focus on five soil depths in only REF and OM3 (Table 2 (available online only)). These amplicon libraries were made from primers targeting the V6-V8 region of the 16S rRNA gene and were amplified according to Gies et al.14 using barcoded universal primers: 926F (5′- CC TAT CCC CTG TGT GCC TTG GCA GTC TCA GAA ACT YAA AKG AAT TGR CGG-3′) and 1392R (5′‐ CGT ATC GCC TCC CTC GCG CCA TCA GAC GGG CGG TGT GTR C-3′). PCR product was pooled, purified, quantified and sequenced as for other libraries.

Whole shotgun metagenomes were generated for a single site in each of the six ecozones resulting in three replicates for each treatment and each soil horizon for each ecozone. At Skulow Lake (SBSBC), sampling for metagenomes focused on changes along the soil profile and, thus, did not cover all four OM harvesting treatments, only REF versus OM3. Unlike in pyrotag libraries, a second complete set of shotgun metagenomes from Skulow Lake does not exist. Insufficient organic layer soil was available from OM3 to prepare shotgun metagenomes for BSON, IDFBC, JPON, and PPCA. The same soil samples were used for shotgun and amplicon metagenomes, but from separate DNA extractions. After quantification, triplicate samples were multiplexed in each Illumina HiSeq lane for sequencing. Samples from ecozones BSON, JPON, PPCA and LPTX were sequenced at the US DOE Joint Genome Institute (Walnut Creek, CA) producing paired-end, 150-bp Illumina libraries while samples for the IDFBC and SBSBC ecozones were sequenced at the Michael Smith Genome Sciences Centre (Vancouver, Canada) resulting in paired-end, 75-bp and 100-bp Illumina libraries, respectively.

Stable isotope probing amplicon and shotgun metagenome sequencing

Microcosms were prepared by adding between 0.75 and 2.0 g of 2 mm sieved organic or mineral layer soil to 30-mL serum vials. Larger quantities of mineral soil were necessary because of lower microbial biomass, requiring two DNA extractions per mineral soil to obtain the necessary 5 μg of DNA. Moisture content was standardized to 60% w/v for mineral soil, due to lower absorptive capacity, and 125% w/v for organic soil and pre-incubating at 20 °C for one week. Microcosms were then amended with either 1.0% w/w of 13C-labeled hemicellulose (97 atom %; IsoLife; U-10509, Lot: 0901-0273) or custom prepared bacterial cellulose (99 atom % 13C). Each soil sample was paired with a microcosm containing the same amount of unlabelled (~1.1 atom % 13C) substrate. Separation between 13C-enriched DNA and unlabelled DNA is never complete, in part, due to variation in GC content15. Thus, 13C-libraries are always compared to identically prepared sequencing libraries from samples amended with unlabelled substrate. Following either 2-day (hemicellulose), 11-day (cellulose—organic layer) or 14-day (cellulose—mineral layer) incubations, soil was lyophilized and stored at −80 °C until DNA was extracted as previously described. DNA extracts from replicates within each site were pooled in equal amounts and unlabelled controls were processed identically. Harvested treatment OM2 was not included in SIP-hemicellulose libraries.

High purity 13C-labled cellulose was necessary to ensure that only organisms possessing the necessary metabolic capability could assimilate the 13C. Bacterial cellulose was utilized due to irremediable impurity in plant-derived cellulose from IsoLife (58% glucose+4.4% lignin+remainder of sugars from hemicellulose). Bacterial cellulose was produced by cultivating Gluconacetobacter xylinus str. KCCM 10,100 with either 13C-labeled glucose (99 atom % 13C, Cambridge Isotope Laboratories, MA, USA), or unlabelled glucose, as sole carbon source in Yamanaka medium16. Cellulose pellicules were purified by boiling in sodium hydroxide per previously described methods17, with the addition of a second boiling step and an increase in boiling time to 4 h. While IsoLife hemicellulose was also impure (53% hemicellulose sugars), the sources of impurity were more recalcitrant forms of carbon, such as cellulose and lignin, which were not substantially degraded during the 2-day incubation.

13C-enriched DNA was separated and recovered using cesium chloride density gradient ultracentrifugation10. The atom % 13C was measured before and after density separation using UHPLC-MS/MS18. Amplicon libraries were prepared and sequenced from 13C-enriched DNA for SIP-hemicellulose (Data Citations 4,5) and SIP-cellulose (Data Citation 6) experiments targeting both bacterial and fungal phylogenetic markers as previously described (Table 4 (available online only)). Four shotgun metagenome libraries were generated from 13C-enriched DNA from SIP-cellulose incubations for REF, OM1 and OM3 treatments and one unlabelled control sample (REF) from PPCA. Sufficient DNA for metagenome library preparation was achieved by pooling the corresponding DNA extracts from mineral layer samples at all three sites in PPCA. Shotgun metagenomes were prepared from 40–50 ng of enriched DNA using the Nextera DNA Sample Preparation Kit (Illumina Inc., CA, USA) and were multiplexed on two lanes of Illumina HiSeq (2×100-bp), yielding 285 million paired-end reads (Data Citation 6). There was insufficient 13C-enriched DNA to generate metagenomes from the organic layer samples. Raw sequences were quality-controlled, assembled and binned into partial genomes (Table 4 (available online only); Data Citation 6) according to methods described in Wilhelm et al.8.

Data Records

The raw pyrosequencing output (~400-bp reads) for all 16S rRNA gene (n=724 samples) and ITS (n=658 samples) amplicon libraries that were generated from field soil samples averaged 8,900 and 8,400 reads per library (post-QC), respectively, and are archived at the European Sequencing Archive (Table 2 (available online only)). The raw SFF files for 16S rRNA amplicon libraries can be found with the study accession PRJEB8599 (Data Citation 1), except for all libraries from British Columbia which were archived in study accession PRJEB12501 in ‘fastq’ format (Data Citation 2). The latter contains the entire collection of ITS amplicon libraries in ‘fastq’ format. All libraries were extracted from raw SFF files using the mothur command ‘sffinfo’ and either uploaded in standard flowgram format (SFF) or converted to ‘fastq’ format19 using ‘sffinfo’ to produce paired ‘fasta’ and ‘qual’ files, which were merged into ‘fastq’ format using ‘PairedFastaQualIterator’ from the SeqIO module in BioPython20.

Raw shotgun metagenomic data for all ecozones can be downloaded in ‘fastq’ format with the study accession PRJEB8420 from the European Nucleotide Archive (Table 3 (available online only), Data Citation 3). After our quality filtering, libraries had a median count of 59.3 million sequences for 150-bp read libraries, while shorter read libraries (75-bp) had higher median counts (115 million). These numbers are provided as an estimate of the number of high quality reads obtainable from our raw data, but will change depending on the parameters selected during quality processing.

Due to cost of 13C-labeled materials and additional labour required to process SIP samples, only a subset of ecozones were selected for SIP-hemicellulose (PPCA & IDFBC) and SIP-Cellulose (PPCA) characterizations. The raw pyrosequencing output (~400-bp reads) for SIP-hemicellulose 16S rRNA (Data Citation 4) and ITS (Data Citation 5) amplicon libraries, which averaged 4,200 and 3,800 reads per library (post-QC), respectively, are available in SFF format from the European Nucleotide Archive (Table 4 (available online only)). These datasets include both 13C- and 12C-libraries for 16S rRNA genes, n=35 and 15, respectively, and for ITS, 18 and 2, respectively. Similarly, the raw sequencing data for all SIP-cellulose 16S rRNA amplicon and ITS amplicon libraries, averaging 11,800 and 10,300 reads per library, respectively, are available in ‘fastq’ format from the European Nucleotide Archive (Table 4 (available online only)). The 13C- and 12C-libraries from these data are more balanced, with a total of 2416S rRNA gene libraries for both, and 24 and 23, respectively, for ITS libraries. Raw Illumina, paired-end, 100-bp shotgun metagenome sequencing libraries for pooled, SIP-cellulose mineral soil incubations were archived in ‘fastq’ format (Data Citation 6; Table 4 (available online only)), along with 10 partial genomes in ‘fasta’ format comprised of assembled scaffolds (Data Citation 6; Sample accessions: ERZ288956—ERZ288966).

Technical Validation

The recovery of 13C-enriched DNA was validated by quantifying 13C-content of nucleic acids18 (Fig. 3). The completeness of draft genomes recovered from SIP-Cellulose metagenomes was assessed by scanning for essential single-copy, house-keeping genes with hidden Markov models21.

Figure 3. The successful enrichment and recovery of 13C-enriched DNA in SIP experiments.

Figure 3

Open in a new tab

The assimilation of 13C by functional guilds during stable isotope probing experiments was evident in (a) the total 13C-enrichment of soil DNA extract and (b) recovery of DNA from the densest CsCl gradient fractions (F1-F7). These differences were evident in comparing soils amended with either 12C- (unlabelled) or 13C-cellulose. These trends were apparent in both cellulose and hemicellulose SIP experiments. Boxplots depict the average (centre line) and spread (from 25th to 75th percentile) of data, while the whiskers extend to the extrema. A total of twelve samples were averaged for each factor.

Usage Notes

Metagenomes for all ecozones, except IDFBC, can be also found at the DOE JGI portal (http://genome.jgi.doe.gov/) under proposal ID 543. This site provides the raw sequencing data and annotation for the assembled and unassembled metagenomes.

Additional Information

Tables 2–4 are only available in the online version of this paper.

How to cite this article: Wilhelm, R. C. et al. A metagenomic survey of forest soil microbial communities more than a decade after timber harvesting. Sci. Data 4:170092 doi: 10.1038/sdata.2017.92 (2017).

Publisher’s note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Material

sdata201792-isa1.zip (21.2KB, zip)

Acknowledgments

This study was supported by grants from Genome Canada and Genome BC as well as an NSERC Strategic Project Grant. Sampling and data collection were contributed by collaborators at the Canadian Forestry Services (Drs Paul Hazlett, Kara Webster, Robert L. Fleming), the Ontario Ministry of Natural Resources (Dr David Morris), BC Ministry of Forests, Lands and Natural Resources Operations (Drs Shannon Berch, Chuck Bulmer, Bill Chapman, Stephane Dubé, Graeme Hope and Marty Kranabetter) and the U.S. Forest Service (Drs Matt Busse and Andy Scott). Drs E.C., M.H. and K.M. were supported by postdoctoral fellowships from the Tula Foundation and both R.C.W. and A.H. by NSERC graduate scholarships. Sequencing conducted by the U.S. Department of Energy Joint Genome Institute, a DOE Office of Science User Facility, is supported by the Office of Science of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231. We also acknowledge the contribution of scientists at the McGill University and Génome Québec Innovation Center, Montréal, Canada.

Footnotes

The authors declare no competing financial interests.

Data Citations

  1. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599
  2. 2016. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501
  3. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420
  4. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181
  5. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182
  6. 2016. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761

References

  1. Powers R. F. et al. The North American long-term soil productivity experiment: Findings from the first decade of research. Forest Ecol. Manag. 220, 31–50 (2005). [Google Scholar]
  2. Thiffault E. et al. Effects of forest biomass harvesting on soil productivity in boreal and temperate forests—A review. Environ. Rev. 19, 278–309 (2011). [Google Scholar]
  3. Ponder F. et al. Effects of organic matter removal, soil compaction and vegetation control on 10th year biomass and foliar nutrition: LTSP continent-wide comparisons. Forest. Ecol. Manag. 278, 35–54 (2012). [Google Scholar]
  4. Holub S. M., Terry T. A., Harrington C. A., Harrison R. B. & Meade R. Tree growth ten years after residual biomass removal, soil compaction, tillage, and competing vegetation control in a highly-productive Douglas-fir plantation. Forest Ecol. Manag. 305, 60–66 (2013). [Google Scholar]
  5. Cardenas E. et al. Forest harvesting reduces the soil metagenomic potential for biomass decomposition. ISME J. 9, 1–12 (2015). [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Hartmann M. et al. Significant and persistent impact of timber harvesting on soil microbial communities in Northern coniferous forests. ISME J. 6, 2199–2218 (2012). [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Leung H. T., Maas K. R., Wilhelm R. C. & Mohn W. W. Long-term effects of timber harvesting on hemicellulolytic microbial populations in coniferous forest soils. ISME J. 10, 363–375 (2016). [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Wilhelm R. et al. Long-term Enrichment of Stress-tolerant Cellulolytic Soil Populations following Timber Harvesting Revealed by Multi-omic Stable Isotope Probing. Front. Microbiol 8, 537 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  9. Wilhelm R. et al. Biogeography and Organic Matter Retention Shape Effects of Timber Harvesting on Forest Soil Microbial Communities in Long-term Soil Productivity Study. ISME J. ; DOI: 10.1038/ismej.2017.109 (2017). [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Neufeld J. D. et al. DNA stable-isotope probing. Nat. Protoc. 2, 860–866 (2007). [DOI] [PubMed] [Google Scholar]
  11. Lane D. J. in Nucleic Acid Techniques in Bacterial Systematics (eds Stackebrandt E. & Goodfellow M.) 115–175 (John Wiley and Sons, 1991). [Google Scholar]
  12. Amann R. I., Ludwig W. & Schleifer K. H. Phylogenetic identification and in-situ detection of individual microbial-cells without cultivation. Microbiol. Rev. 59, 143–169 (1995). [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. White T. J., Bruns T., Lee S., & Taylor J. in PCR Protocols: a Guide to Methods and Applications (eds Innis M. A., Gelfand D. H., Sninsko J. J. & White T. J.) 315–322 (Academic Press, 1990). [Google Scholar]
  14. Gies E. A., Konwar K. M., Beatty T. & Hallam S. J. Illuminating Microbial Dark Matter in Meromictic Sakinaw Lake. Appl. Env. Microbiol 80, 6807–6818 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. Youngblut N. D. & Buckley D. H. Intra-genomic variation in G+C content and its implications for DNA stable isotope probing. Environ. Microbiol. Rep 6, 767–775 (2014). [DOI] [PubMed] [Google Scholar]
  16. Ruka D. R., Simon G. P. & Dean K. M. Altering the growth conditions of Gluconacetobacter xylinus to maximize the yield of bacterial cellulose. Carbohyd. Polym. 89, 613–622 (2012). [DOI] [PubMed] [Google Scholar]
  17. Pinnell L. J., Dunford E. A., Ronan P., Hausner M. & Neufeld J. Recovering glycoside hydrolase genes from active tundra cellulolytic bacteria. Can. J. Microbiol. 60, 469–476 (2014). [DOI] [PubMed] [Google Scholar]
  18. Wilhelm R., Szeitz A., Klassen T. L. & Mohn W. W. Sensitive, Efficient Quantitation of 13C-Enriched Nucleic Acids via Ultrahigh-Performance Liquid Chromatography–Tandem Mass Spectrometry for Applications in Stable Isotope Probing. Appl. Environ. Microbiol. 80, 7206–7211 (2014). [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Schloss P. D. et al. Introducing mothur: open-source, platform-independent, community-supported software for describing and comparing microbial communities. Appl. Environ. Microbiol. 75, 7537–7541 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Cock P. J. A. et al. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics 25, 1422–1423 (2009). [DOI] [PMC free article] [PubMed] [Google Scholar]
  21. Albertsen M. et al. Genome sequences of rare, uncultured bacteria obtained by differential coverage binning of multiple metagenomes. Nat. Biotechnol. 31, 533–538 (2013). [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Citations

  1. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB8599
  2. 2016. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB12501
  3. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB8420
  4. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB9181
  5. 2015. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB9182
  6. 2016. European Nucleotide Archive. https://www.ebi.ac.uk/ena/data/search?query=PRJEB9761

Supplementary Materials

sdata201792-isa1.zip (21.2KB, zip)

Articles from Scientific Data are provided here courtesy of Nature Publishing Group

RESOURCES