TABLE 1.
Primers used for the detection of E. coli ST131 clades
| Assay and primer | Nucleotide sequence (5′-3′) | Primer concn (μM) | Target | PCR product size (bp) | Reference or source |
|---|---|---|---|---|---|
| ST131 clade assay | |||||
| CladeAspe4-YF5 | TGACGGGACGTGAGCAAATTA | 0.15 | Clade A specific (region 4) | 707 | This study (Table S1) |
| CladeAspe4-YR5 | AGTCAGACCTAGCCACCCTT | 0.15 | |||
| ST131_R19-YF1 | AGCAACGATATTTGCCCATT | 0.15 | ST131 specific (region 19) | 580 | 11; this study |
| ST131_R19-YR1 | GGCGATAACAGTACGCCATT | 0.15 | |||
| prfC-1615spe0-YF1 | CAACGTTGAAGCAGTGTATGAG | 0.08 | prfC SNPs specific for the clade B | 442 | This study (Table S2) |
| prfC-d2034-YR1 | TGACAATCGACGGCTTTAGA | 0.08 | |||
| C1-578spe-YF1 | GGCCCCACAAATTGCTT | 0.1 | Clade C1 | 337 | This study (Table S2) |
| C1-898-YR1 | CGCACCTCCGATACCAAA | 0.1 | |||
| M27PP1C-YF1 | TGAATCAAAGGTCCGAGCTG | 0.08 | M27PP1 region specific for the C1-M27 subclade | 232 | 8; LC209430a |
| M27PP1C-YR1 | TATGGCTGGCAGATGCTTTA | 0.08 | |||
| nrdI-534spe2-YF1 | ACGGATTCAGGTAGACGATT | 0.25 | nrdI SNP specific for the C2 clade | 164 | This study (Table S2) |
| nrdI-678R | CCTCACCAAAGTTGCGATTAC | 0.25 | |||
| C-SNP1-700spe-YF1 | CGCTGGCCAGTTATCTGAAAT | 0.2 | mgtA SNPs specific for the C clade | 103 | This study (Table S2) |
| C-SNP1-762spe-YR2 | CCTTTCACCAACTGGGTTACT | 0.2 | |||
| C1-M27 subclade assay | |||||
| ST131_R19-YF1 | AGCAACGATATTTGCCCATT | 0.15 | ST131 specific (region 19) | 580 | 11; this study |
| ST131_R19-YR1 | GGCGATAACAGTACGCCATT | 0.15 | |||
| M27aer-spe-YF1 | GCCGATGGGCTTTCCT | 0.15 | aer SNP specific for the C1-M27 subclade | 140 | This study (Table S2) |
| M27aer-YR2 | GTCACCGCGTCTTCCAGT | 0.15 |
GenBank/ENA/DDBJ accession number.