Table 1.
Locus | Primer sequences (5′ → 3′) | Cloned repeat | No. of alleles | n | Heterozygosity
|
Excl. Prob. | |
---|---|---|---|---|---|---|---|
Obs. | Exp. | ||||||
Pmin05 | TTTCCCCCGAACAACACAAC | [GT]31 | 56 | 62 | 0.968 | 0.979 | 0.942 |
TTCCCATGCCTCCTTTTGTC | |||||||
Pmin01 | CACAAAGTCAATCCTAAATA | [GT]41 | 63 | 62 | 0.968 | 0.984 | 0.952 |
CCAAACTGTTTAGCACTG | |||||||
Pmin10 | AACCGCCCAATCCACAAC | [GT]25 | 17 | 16 | 0.938 | 0.956 | 0.850 |
GAATGTCCCGAGAAACTGGAG |
Shown are primer sequences, the sequence of the original cloned microsatellite, and the number of alleles per locus in an adult sample of n individuals. Also shown are expected and observed heterozygosities as well as expected exclusion probabilities (given a known mother–offspring pair; ref. 28).