. 2001 Jul 31;98(16):9151–9156. doi: 10.1073/pnas.171310198

Table 1.

Summary of information for the three sand goby microsatellite loci

Locus	Primer sequences (5′ → 3′)	Cloned repeat	No. of alleles	n	Heterozygosity		Excl. Prob.
Locus	Primer sequences (5′ → 3′)	Cloned repeat	No. of alleles	n	Obs.	Exp.	Excl. Prob.
Pmin05	`TTTCCCCCGAACAACACAAC`	[GT]₃₁	56	62	0.968	0.979	0.942
	`TTCCCATGCCTCCTTTTGTC`
Pmin01	`CACAAAGTCAATCCTAAATA`	[GT]₄₁	63	62	0.968	0.984	0.952
	`CCAAACTGTTTAGCACTG`
Pmin10	`AACCGCCCAATCCACAAC`	[GT]₂₅	17	16	0.938	0.956	0.850
	`GAATGTCCCGAGAAACTGGAG`

Shown are primer sequences, the sequence of the original cloned microsatellite, and the number of alleles per locus in an adult sample of n individuals. Also shown are expected and observed heterozygosities as well as expected exclusion probabilities (given a known mother–offspring pair; ref. 28).