Table 4.
Variant calling for case studies 1 and 2.
| Position in the | |||
|---|---|---|---|
| Case study | Type | Variants | assembled genome |
| Case study 1 | Mismatch | G (ref) > T (ass) | 127404 |
| Case study 2 | Insertion | AGGTACCTAA | 7653–7662 |
| Insertion | Homopolymer T region | 18272–18274 | |
| Insertion | Homopolymer A region | 18614 | |
| Insertion | Homopolymer A region | 34160 | |
| Insertion | CT | 43329–43330 | |
| Insertion | Homopolymer A region | 56672–56673 | |
| Mismatch | CTCTC (ref) > TCTCT (ass) | 76298–76302 | |
| Deletion | Homopolymer A region | 78860 | |
| Insertion | TTTACTTTTATGTTTTATTTG | 107322–107342 | |
| Insertion | GCAATAATCTACTAAAAAAA | 109678–109697 | |
| Mismatch | G (ref) > N (ass) | 109894 | |
| Mismatch | T (ref) > N (ass) | 109893 |