Skip to main content
. 2017 Jul 12;8(7):178. doi: 10.3390/genes8070178

Table 1.

Molecular Genetic Results for EYS-retinitis pigmentosa (RP) Patients.

Patient Allele 1 Allele 2
Nucleotide Change Amino Acid Change or Predicted Effect First Reports of Mutation Nucleotide Change Amino Acid Change or Predicted Effect First Reports of Mutation
P1 c.1155T>A p.(Cys385Ter) This Study c.8648_8655delCATGCAGA p.(Thr2883LysfsTer4) [26]
P2 c.2137+1G>A p.? This Study c.2137+1G>A p.? This Study
P3 c.490C>T p.(Arg164Ter) [27] c.2260-1437_2847-6134del p.(Ser754IlefsTer4) This Study
P4 c.4829_4832delCATT p.(Ser1610PhefsTer7) This Study c.5928-2A>G p.? [28]
P5 a c.7919G>A p.(Trp2640Ter) [1] c.8411_8412insTT p.(Thr2805Ter) This Study
P6 c.32dupT p.(Met12AspfsTer14) [29] c.32dupT p.(Met12AspfsTer14) [29]
P7 c.9286_9295delGTAAATATCG p.(Val3096LysfsTer28) [30] c.2259+10539_2993-12013del p.(Ser754AlafsTer6) [1] b
P8 c.490C>T p.(Arg164Ter) [27] c.2826_2827delAT p.(Val944GlyfsTer9) [31]
P9 c.2889T>A p.(Cys963Ter) This Study c.2889T>A p.(Cys963Ter) This Study
P10 c.(1766+1_17671)_(2023+1_2024-1)del p.(Cys590TyrfsTer4) [1] b c.(1766+1_17671)_(2023+1_2024-1)del p.(Cys590TyrfsTer4) [1] b
P11 a c.2259+1G>A p.? [8] c.8338_8342delins c p.(Gly2780_Ser2781 delinsTyrLysLeuTer) This Study
P12 c.6528C>A p.(Tyr2176Ter) This Study c.6528C>A p.(Tyr2176Ter) This Study
P13 c.8408dupA p.(Asn2803LysfsTer9) [29] c.5834delA p.(Lys1945SerfsTer42) [2]
P14 c.6416G>A p.(Cys2139Tyr) [32] c.6416G>A p.(Cys2139Tyr) [32]
P15 c.9286_9295delGTAAATATCG p.(Val3096LysfsTer28) [30] c.9286_9295delGTAAATATCG p.(Val3096LysfsTer28) [30]

a segregation analysis was performed, and mutations were confirmed to be on separate alleles; b similar to mutation previously reported by this reference; c inserted sequence: TATAAACTATAACTATAAACTATAAACTATAAACTATAAACTATAAACTATAAACTATA.