Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
| SCAR | 5′-primer | Sequence (5′-3′) | 3′-primer | Sequence (5′-3′) | Probe |
|---|---|---|---|---|---|
| BC10-1 | BC10-1L87 | cccaggcagtagtgtagggta | BC10-1R87 | ccctcctctccatttctcaa | 87 |
| BC13-4 | BC13-4L34 | tctggcttcttcccaaacac | BC13-4R34 | cgcggtgtcagttactatgg | 34 |
| beta-actin | Q-b-actin55LG | aagtcccttgccatcctaaaa | Q-b-actin55RG | atgctatcacctcccctgtg | 55 |
Abbreviations: SACR, sequence-characterized amplified region.
