Table 1. Clinical features and analysis of the 41 MICPCH patients.
| Patient | Gender | Age | OFC (SD) | Developmental delay |
Muscular hypotonia |
Seizures | Other clinical featuresa | Gene(s) in which mutation was found | Mutation | Inher-itancec | Previous report | ||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| At birth | Present | Description | Detectionb | ||||||||||
| 1 | F | 2y8m | -3.2 | -4.3 | Severe | + | - | CASK | c.79C>T (p.R27*) | DS | NA | Patient 1 in [7] | |
| 2 | F | 1y5m | -1.2 | -3.6 | Severe | + | - | CASK | c.79C>T (p.R27*) | DS | NA | ||
| 3 | F | 2y0m | -2.3 | -3.5 | Moderate | + | - | Bilateral hydronephrosis | CASK | c.316C>T (p.R106*) | DS | NA | Patient 2 in [7] |
| 4 | F | 4y3m | -9.2 | Very severe | + | CASK | c.316C>T (p.R106*) | DS | NA | Patient 3 in [9] | |||
| 5 | F | 1y | -3.6 | Severe | - | - | VE | CASK | c.868G>T (p.E290*) | DS | NA | ||
| 6 | F | 2y8m | -2.8 | -4.0 | Severe | - | - | Severe hyperopia | CASK | c.2632C>T (p.Q878*) | DS | dn | Patient 3 in [7] |
| 7 | F | 11m | -0.8 | -3.2 | Severe | - | - | CASK | c.243_244delTA (p.Y81*) | DS | NA | Patient 4 in [7] | |
| 8 | F | 5m | -0.9 | -4.5 | Presentd | + | - | CASK | c.761_762delCT (p.S246*) | DS | dn | ||
| 9 | F | 15y | -6.4 | Severe | + | + | CASK | c.1006_1012delACCTCCT (p.T336Qfs*23) | DS | NA | |||
| 10 | F | 4y2m | -4.0 | Severe | CASK | c.2103delT (p.F701Lfs*26) | DS | NA | |||||
| 11 | F | 1y | -1.4 | -6.0 | Severe | - | - | Large tongue | CASK | c.1677dupG (p.R560Afs*20) | WES | dn | |
| 12 | F | 11y | -6.8 | Severe | + | Hypertonia, scoliosis | CASK | c.1896dupC (p.C633Lfs*2) | DS | NA | |||
| 13 | F | 17y | -1 | -6.0 | Severe | + | CASK | c.2508delT (p.L837*) | DS | NA | |||
| 14 | F | 7y | -0.3 | -4.0 | Severe | CASK | c.173_173+1delGG | DS | NA | Patient 2 in [9] | |||
| 15 | F | 7y9m | -3.4 | -4.5 | Severe | - | - | CASK | c.357-1G>A | DS | dn | Patient 5 in [7] | |
| 16 | F | 1y | -4.8 | Moderate | CASK | c.1582+G>A | DS | NA | |||||
| 17 | F | 14y | -0.4 | -6.0 | Moderate | - | CASK | c.2040-1G>C | DS | dn | Patient 6 in [7] | ||
| 18 | F | 3y | -3.0 | CASK | c.2302+1G>T | DS | NA | ||||||
| 19 | F | 11y | -5.0 | Moderate | CASK | c.2302+1delT | DS | NA | Patient 1 in [9] | ||||
| 20 | F | 8y | -3.0 | Severe | CASK | c.1910G>A (p.G637D) | DS | NA | Patient 4 in [9] | ||||
| 21 | M | 2y | -1 | -4.1 | Severe | CASK | c.1061T>C (p.L354P) | DS | NA | Patient 16 in [9] | |||
| 22 | M | 4y4m | -4.9 | CASK | c.317G>C (p.R106P) | DS | dn | ||||||
| 23 | M | 2y | -1.1 | -3.2 | Severe | + | + | CASK | c. [= /1493_1503+10delATGAACCAATGGTAAGTAGGAinsGG] (p.D498Gfs*12) |
DS | NA | ||
| 24 | F | 5y | -3.1 | -6.0 | Severe | - | - | Squint with nystagmus and myopia, minor anomaliese | CASK | arr Xp11.4p11.3(41,500,243–45,480,187)x1 | MA | dn | Patient in [3] |
| 25 | F | 1y9m | -4.3 | -4.6 | Severe | + | - | Bilateral sensorineuronal deafness | CASK | arr Xp11.4p11.3(41,009,876–44,100,501)x1 | MA | dn | Patient 7 in [7] |
| 26 | F | 6y4m | -0.8 | -3.2 | Severe | + | Preterm birth at 33 weeks | CASK | arr Xp11.4p11.3(41,618,898–43,755,475)x1 | MA | dn | ||
| 27 | F | 2y0m | -1.3 | -4.0 | Moderate | - | - | CASK | arr Xp11.4p11.3(41,337,795–42,468,013)x1 | MA | dn | Patient 8 in [7] | |
| 28 | F | 4y | -2 | -4.0 | CASK | arr Xp11.4p11.3(41,145,925–46,090,321)x1 | MA | NA | |||||
| 29 | F | 12y8m | -4.8 | -8.0 | Severe | Glaucoma, PHPV | CASK | arr Xp11.4p11.3(41,163,139–44,592,980)x1 | MA | NA | |||
| 30 | F | 12y | -1.9 | -5.4 | Severe | + | Severe scoliosis, strabismus | CASK | arr Xp11.4(41,405,593–41,570,391)x3 | MA | NA | Patient 9 in [7] | |
| 31 | F | 7y2m | -1.5 | -5.2 | Severe | + | + | Internal strabismus | CASK | arr Xp11.4(41,382,179–41,540,922)x3 arr Xp11.22(56,012,908–56,275,153)x3 |
MA | dn | Patient 10 in [7] |
| 32 | F | 0 | -4.4 | Severe | CASK | arr Xp11.4(41,442,660–41,527,850)x3 | MA | NA | |||||
| 33 | F | 10y | -0.9 | -3.5 | Severe | - | + | Hypoplastic CC, minor anomaliesf | HDAC2, MARCKS | arr 6q21q22.31(109,497,085–122,505,593)x1 | MA | NA | |
| 34 | F | 2y | -4.0 | Severe | + | Hirsutism, characteristic face | RELN | c.4918A>G (p.I1640V) | TR | NA | |||
| 35 | M | 4y6m | -5.0 | Severe | Hypoplastic CC | RELN | c.7093G>A (p.V2365M) | TR | NA | ||||
| 36 | M | 3y | 0.2 | -1.7 | Severe | Thick CC | ITPR1 | c.7753A>C (p.T2585P) | WES | dn | |||
| 37 | F | -0.8 | Moderate | + | - | VSD, minor anomaliesh | DYNC1H1, DCTN1 | DYNC1H1 c.11824C>T (p.P3942S), DCTN1 c.497C>G (p.S166C) | WES | pat,matg | |||
| 38 | F | -0.6 | -5.2 | Severe | + | + | Internal strabismus, VE | ni | |||||
| 39 | F | 4y | -1 | -3.1 | Moderate | Hyperopia | ni | ||||||
| 40 | F | 5y | normal | -3.0 | Severe | ni | |||||||
| 41 | F | 5y | 0.6 | ||||||||||
SD: standard deviation, ni: not identified
a PHPV: persistent hyperplastic primary vitreous CC: corpus callosum VE: ventricular enlargement
b DS: direct sequencing WES: whole exome sequencing MA: microarray TR: target resequencing
c dn: de novo m: maternal NA: Not available
d The severity has not been estimated correctly because of patient's age.
e Hirsutism, low hairline, arching of eyebrows with sparse lateral third, earlobe sinuses, micrognathia, proximally placed thumbs, brachydactyly and clinodactyly of the 5th fingers
f Widely spaced eyes, downslanted palpebral fissure, Epicanthus, thick and small auricle, short philtrum, cubitus varus, short finger, proximal placement of thumb
g DCTN1 mutation was paternally and DYNC1H1 mutation was maternally inherited, respectively.
h Bilateral. preaxial polysyndactyly of toes, prominent forehead, depressed nasal root