REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Rabbit polyclonal anti-Kibra	this paper	N/A
Alexa Fluor 647-conjugated goat anti-rabbit antibody	ThermoFisher	A-21245; RRID: AB_2535813
Chemicals, Peptides, and Recombinant Proteins
Potassium chloride (KCl)	Sigma	P5405-500G; CAS: 7447-40-7
Potassium acetate (K-acetate)	Sigma	P1190-500G; CAS: 127-08-2
Potassium HEPES (K-HEPES)	Sigma	H0527-100G; CAS: 82207-62-3
Serotonin creatinine sulfate monohydrate (5-HT)	Sigma	H7752-250MG; CAS: 61-47-2
Fast Green FCF	Sigma	F7252-5G; CAS: 2353-45-9
L-15 Medium (Leibovitz)	Sigma	L5520-500ML
Rapamycin	Calbiochem	Cat# 553211
Hemolymph	From adult Aplysia californica	N/A
Artificial sea water from Instant Ocean sea salt	Instant Ocean	Product No. SS15-10
Critical Commercial Assays
MidiPrep for generating DNA for injections	Invitrogen	K210004
Experimental Models: Organisms/Strains
Aplysia californica	NIH/University of Miami national Resource for Aplysia	N/A
Oligonucleotides
KIbra start inside for cloning GGGTCTAGAGAAATATGCCAGAGAGGGGCAG	this paper	N/A
KIbra start outside for cloning GTTTAGATGAAATATGCCAGA	this paper	N/A
KIbra end outside for cloning CAACAGAAACTCCACCAAGCT	this paper	N/A
Kibra end inside for cloning GGGGGATCCGCCTGCTTACACTTCTTCACC	this paper	N/A
Kibra outside reverse for mutation CACTCAGCCAACTTGGCAACT	this paper	N/A
Kibra reverse for mutation AGCTAGAGCTCGAGCGCTGACAGTATTTCTCTGA	this paper	N/A
KIbra forward for mutation	this paper	N/A
GCTCGAGCTCTAGCTTGGAAGCGGGCTGATGGCA	this paper	N/A
KIbra outside forward for mutation ACACGCTGAGGGAAGTGAAG	this paper	N/A
Recombinant DNA
pNEX mRFP-dn PKM Apl I	[21]	N/A
pNEX mRFP-dn PKM Apl III	[20]	N/A
pNEX mRFP-PKM Apl I	[21]	N/A
pNEX mRFP PKM Apl II	[22]	N/A
pNEX mRFP PKM Apl III	[20]	N/A
pNEX Kibra	this paper	N/A
pNEX dn Kibra	this paper	N/A
pNEX eGFP	[49]	N/A
pNEX mRFP	[50]	N/A
pNEX dn ApCCAL1 calpain	[21]	N/A
pNEX dn ApSOL calpain	[21]	N/A