Table 2. Primers used in this study for the detection of the new mcr-4 gene.

Primer name	Sequence	Target	Amplicon size
Mcr-4 FW	ATTGGGATAGTCGCCTTTTT	primers for the screening of the new mcr-4 gene	487 bp
Mcr-4 RV	TTACAGCCAGAATCATTATCA	primers for the screening of the new mcr-4 gene	487 bp
Mcr-4 ext FW	ATCTGTTAAGTTTGTTGGTGAC	external primers to amplify the complete mcr-4 gene	1,820 bp
Mcr-4 ext RV	TGAGAGCTAAATGTAACAATAGA	external primers to amplify the complete mcr-4 gene	1,820 bp
ColE10_repBF	TAAAGCATCGTGTAGTGTTTT	primers for the detection of the repB of the ColE10 plasmid	420 bp
ColE10_repBR	ATATAATCTGGAACATGTTAAG		420 bp
IS5FW	CATGACCTCAATCAGCTGG	In combination with ColE10_repBF, used for PCR-based closure of pMCR	4,588 bp
IS5 RV	TTTACTGAGATCTCTCCCAC	In combination with Mcr-4-RV, used for PCR-based closure of pMCR	2,143 bp