Skip to main content
. 2005 Mar 14;4:16. doi: 10.1186/1475-2875-4-16

Table 1.

Oligonucleotide sequences used in the Hot Ligation

Description Oligo Name bp Positiona Oligo sequence 5' – 3' Modifications
Suspt. East kdr detector Kdr104L-DTe 311-15i ATTTGCATTACTTACGACTA 5' Biotin
Resist. East kdr detector Kdr104S-DTe 311-15i ATTTGCATTACTTACGACTG 5' Biotin
East kdr reporter Kdr104-RTe 291–310 AATTTCCTATCACTACAGTG 5' Phosphorylation
3' Fluorescein
Suspt. West kdr detector Kdr104L-DTw 312-16i AATTTGCATTACTTACGACT 5' Biotin
Resist. West kdr detector Kdr104F-DTw 312-16i AATTTGCATTACTTACGACA 5' Biotin
West kdr reporter Kdr104-RTw 292–311 AAATTTCCTATCACTACAGT 5' Phosphorylation
3' Fluorescein

aUsing sequence from Martinez-Torres et al., as reference; i intron 2 position.