Table 1.

Primers for Genes Whose Expression Was Evaluated by the SYBR Green Method

Gene (GenBank ID)	F primer sequence (5′–3′)	R primer sequence (5′–3′)	Expected product size
RFX6 (306518575)	TCTCTTTGACCAGCATGTCG	CTGTGCTGCCTGAAATGGTA	104 bp spanning region within exon 12
CFTR (306514)	CTATGACCCGGATAACAAGGAGG	CAAAAATGGCTGGGTGTAGGA	107 bp spanning region within exon 4 of all transcript variants
RFX3 (Harvard PrimerBank ID 19743882c2)	CCAGGTGACTACCGTGGTCT	GCTGCTGATGAGTTGTCCTCC	88 bp spanning region within exon 1

The table lists the genes whose expression was evaluated by the SYBR^® Green method. The corresponding forward (F) and reverse (R) primer sequences and the region it spans in the target gene are also mentioned.