Table 2. Plasmids used in this study.

Name	Alias	Description	Source
pVJ2	pDN431	CPY*-HA driven by PRC1 promoter CPY* = CPY with G255R point mutation	Ng, Spear & Walter (2000)
pVJ27	pRS316	Empty vector	Sikorski & Hieter (1989)
pVJ312	pRS316-GAL1/10-Deg1-Sec62-ProtA-N153D	Deg1-Sec62-ProtA-N153D driven by GAL1/10 promoter	Scott & Schekman (2008)
pVJ317	pRS416-MET25-Deg1*-Sec62-ProtA	Deg1*-Sec62-ProtA driven by MET25 promoter Deg1* =Deg1 with F18S, I22T point mutations	Rubenstein et al. (2012)
pVJ518	pRS416-MET25-Deg1*-Sec62-ProtA-2R	Deg1*-Sec62-ProtA-2R driven by MET25 promoter 2R = K3R, K7R point mutations Generated via site-directed mutagenesis of plasmid pVJ317 using primers VJR270 (5′ GAATAGAATTCCCATTAGAGACCTTTTAAATC 3′) and VJR271 (5′ GGTCTCTAATGGGAATTCTATTCATGGATCC 3′), which mutate Lys3 and Lys7 to Arg and introduce a silent EcoRI restriction site.	This study
pVJ527	pRS416-MET25-Deg1*-Sec62-ProtA-3R	Deg1*-Sec62-ProtA-3R driven by MET25 promoter 3R = N2R, K3R, K7R point mutations Generated via site-directed mutagenesis of plasmid pVJ518 using primers VJR280 (5′ CATGAGAAGAATACCCATTAGAGACCTTTTAAATC 3′) and VJR281 (5′ CTAATGGGTATTCTTCTCATGGATCCACTAG 3′), which mutate Asn2 to Arg and silently remove an EcoRI restriction site.	This study

Notes.

All plasmids used in this study are yeast CEN plasmids, harbor the AmpR gene for selection of ampicillin-resistant E. coli, and the URA3 gene for selection for uracil prototrophy in yeast.