Table S4.
Primers used to amplify sequences surrounding target sites
| Primer name | Target site | Sequence (5′ to 3′) |
| DmFDLsurv-Fw | DmFDLt3 | acaggcctggtggtggtgtc |
| DmFDLsurv-Rv | DmFDLt3 | aaagttaagatccccggatttgagcac |
| SfFDLt12-Fw | SfFDLt1, SfFDLt2 | ggcagtttctaaccgcttacttttg |
| SfFDLt12-Rv | SfFDLt1, SfFDLt2 | cttactcgtagagagcgtgcagc |
| SfFDLt3-Fw | SfFDLt3 | cgcggacttctccttgacacag |
| SfFDLt3-Rv | SfFDLt3 | cgaacccgcagtccaggtac |
| TnFDLsurv-Fw | TnFDLt | atgaagtggtggggcga |
| TnFDLsurv-Rv | TnFDLt | gccacagctgtgtcgagtc |
| BmFDLsurv-Fw | BmFDLt1, BmFDLt2, BmFDLt3 | cttttatttatcgattcgggc |
| BmFDLsurv-Rv | BmFDLt1, BmFDLt2, BmFDLt3 | gaatgcgctgtgatgtctac |