Table S4.

Primers used in this study

Primer name	Sequence, 5′ to 3′	Target
ΔpycA_USF_XhoI	AAACTCGAGCCAGGAATTGGGACGGTACA	Use with ΔpycA_USR for amplification of ΔpycA US fragment.
		Use with ΔpycA_DSR_PstI for fusing pycA US and DS fragments and for confirmation of pycA deletion.
		XhoI site is underlined.
ΔpycA_USR	CCTTTGACAACATGAAGGGCAACGGCGATTTCTCCACGATTG	Use with ΔpycA_USF_XhoI for amplification of ΔpycA US fragment.
ΔpycA_DSF	TTGCCCTTCATGTTGTCAAAGG	Use with ΔpycA_DSR_PstI for amplification of ΔpycA DS fragment.
ΔpycA_DSR_PstI	AAACTGCAGCTCCACCATGTTTTGGCCCT	Use with ΔpycA_DSF for amplification of ΔpycA DS fragment.
		Use with ΔpycA_USF_XhoI for fusing pycA US and DS fragments and for confirmation of pycA deletion.
		PstI site is underlined.
Int_check	CTACGGTTCCTGACCAATTG	Use with RUP – product formation indicates pRV300ΔpycA integration into genome either upstream or downstream of pycA, and for checking pRV300pycAG746A or pRV300pycAY715T integration into genome.
RUP	CAGGAAACAGCTATGAC	Plasmid-specific primer. Use as above.
pycAY715T_USF_XhoI	AAACTCGAGGGTTCTGGAGAAATCTATGT	Use with pycAY715T_USR for amplification of pycAY715T US fragment.
		Use with pycAY715T_DSR_PstI for fusing pycAY715T US and DS fragments.
		XhoI site is underlined.
pycAY715T _USR	CTGAAATCAAGCGAGTTGCCGCTTGAGG	Use with pycAY715T_USF_XhoI for amplification of pycAY715T US fragment. Bold indicates the nucleotide change introduced.
pycAY715T_DSF	CCTCAAGCGGCAACTCGCTTGATTTCAG	Use with pycAY715T_DSR_PstI for amplification of pycAY715T DS fragment. Bold indicates the nucleotide change introduced.
pycAY715T_DSR_PstI	AAACTGCAGTCCTGCTAAAACACCTTTTCCA	Use with pycAY715T_DSF for amplification of pycAY715T DS fragment.
		Use with pycAY715T_USF_XhoI for fusing pycAY715T US and DS fragments.
		PstI site is underlined.
pycAG746A_USF_XhoI	AAACTCGAGGCCGTAGGACTCTCACCAGA	Use with pycAG746A_USR for amplification of pycAG746A US fragment.
		Use with pycAG746A_DSR_PstI for fusing pycAG746A US and DS fragments.
		XhoI site is underlined.
pycAG746A_USR	CCTGCTTGAGTTGCAGCAGAATAGG	Use with pycAG746A_USF_XhoI for amplification of pycAG746A US fragment. Bold indicates the nucleotide change introduced.
pycAG746A_DSF	CCTATTCTGCTGCAACTCAAGCAGG	Use with pycAG746A_DSR_PstI for amplification of pycAG746A DS fragment. Bold indicates the nucleotide change introduced.
pycAG746A_DSR_PstI	AAACTGCAGTCCTGCTAAAACACCTTTTCCA	Use with pycAG746A_DSF for amplification of pycAG746A DS fragment.
		Use with pycAG746A_USF_XhoI for fusing pycAG746A US and DS fragments.
		PstI site is underlined.
SNP_F_ex_check	GATAGCCTCAACTGGTTGC	Use with SNP_R_ex_check for amplification of fragment containing desired pycA mutation for sequencing.
SNP_R_ex_check	GCTCGTAATTCCTGCCTC	Use with SNP_F_ex_check for amplification of fragment containing desired pycA mutation for sequencing.
OE_pycA_USF_PstI	TTTCTGCAGTTTCTAATCACTATAGTAGCAGTG	Use with OE_pycA_DSR_XhoI for amplification of entire pycA, pycAY715T, and pycAG746A genes for cloning into pGh9.
		PstI site is underlined.
OE_pycA_DSR_XhoI	TTCCTCGAGACCTCCATCTATTTCATTATTATAC	Use with OE_pycA_USF_PstI for amplification of entire pycA, pycAY715T, and pycAG746A genes for cloning into pGh9.
		XhoI site is underlined.