Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for qRT-PCR
| Gene | Forward | Reverse | Accession Number |
|---|---|---|---|
| Col1 | ttgaccctaaccaaggatgc | cagttcttggctgggatgtt | NM_000089 |
| Col3 | gatcaggccagtggaaatgt | gtgtgtttcgtgcaaccatc | NM_000090 |
| CTGF | tcccacccaattcaaaacat | tgctcctaaagccacacctt | NM_001901 |
| SERPINE1 | ctctctctgccctcaccaac | gtggagaggctcttggtctg | NM_000602 |
| GAPDH | cagcctcaagatcatcagca | tgtggtcatgagtccttcca | NM_001256799 |
